ID: 1186266909

View in Genome Browser
Species Human (GRCh38)
Location X:7843018-7843040
Sequence ATGGTGCTTTGTGACGTATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 3, 1: 3, 2: 0, 3: 2, 4: 64}

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186266896_1186266909 10 Left 1186266896 X:7842985-7843007 CCCCCCGCCCCCGACTTCATCCG 0: 6
1: 0
2: 0
3: 17
4: 189
Right 1186266909 X:7843018-7843040 ATGGTGCTTTGTGACGTATAAGG 0: 3
1: 3
2: 0
3: 2
4: 64
1186266892_1186266909 14 Left 1186266892 X:7842981-7843003 CCCCCCCCCCGCCCCCGACTTCA 0: 4
1: 0
2: 14
3: 158
4: 2815
Right 1186266909 X:7843018-7843040 ATGGTGCTTTGTGACGTATAAGG 0: 3
1: 3
2: 0
3: 2
4: 64
1186266898_1186266909 8 Left 1186266898 X:7842987-7843009 CCCCGCCCCCGACTTCATCCGCC 0: 6
1: 0
2: 1
3: 8
4: 151
Right 1186266909 X:7843018-7843040 ATGGTGCTTTGTGACGTATAAGG 0: 3
1: 3
2: 0
3: 2
4: 64
1186266906_1186266909 -10 Left 1186266906 X:7843005-7843027 CCGCCATGTCCTGATGGTGCTTT 0: 5
1: 1
2: 1
3: 14
4: 231
Right 1186266909 X:7843018-7843040 ATGGTGCTTTGTGACGTATAAGG 0: 3
1: 3
2: 0
3: 2
4: 64
1186266897_1186266909 9 Left 1186266897 X:7842986-7843008 CCCCCGCCCCCGACTTCATCCGC 0: 6
1: 0
2: 1
3: 11
4: 212
Right 1186266909 X:7843018-7843040 ATGGTGCTTTGTGACGTATAAGG 0: 3
1: 3
2: 0
3: 2
4: 64
1186266902_1186266909 2 Left 1186266902 X:7842993-7843015 CCCCGACTTCATCCGCCATGTCC 0: 6
1: 0
2: 0
3: 5
4: 72
Right 1186266909 X:7843018-7843040 ATGGTGCTTTGTGACGTATAAGG 0: 3
1: 3
2: 0
3: 2
4: 64
1186266890_1186266909 30 Left 1186266890 X:7842965-7842987 CCTCATTAGATGTCACCCCCCCC 0: 4
1: 2
2: 0
3: 7
4: 99
Right 1186266909 X:7843018-7843040 ATGGTGCTTTGTGACGTATAAGG 0: 3
1: 3
2: 0
3: 2
4: 64
1186266895_1186266909 11 Left 1186266895 X:7842984-7843006 CCCCCCCGCCCCCGACTTCATCC 0: 6
1: 1
2: 6
3: 39
4: 549
Right 1186266909 X:7843018-7843040 ATGGTGCTTTGTGACGTATAAGG 0: 3
1: 3
2: 0
3: 2
4: 64
1186266900_1186266909 6 Left 1186266900 X:7842989-7843011 CCGCCCCCGACTTCATCCGCCAT 0: 6
1: 0
2: 0
3: 10
4: 97
Right 1186266909 X:7843018-7843040 ATGGTGCTTTGTGACGTATAAGG 0: 3
1: 3
2: 0
3: 2
4: 64
1186266894_1186266909 12 Left 1186266894 X:7842983-7843005 CCCCCCCCGCCCCCGACTTCATC 0: 6
1: 0
2: 4
3: 62
4: 650
Right 1186266909 X:7843018-7843040 ATGGTGCTTTGTGACGTATAAGG 0: 3
1: 3
2: 0
3: 2
4: 64
1186266901_1186266909 3 Left 1186266901 X:7842992-7843014 CCCCCGACTTCATCCGCCATGTC 0: 6
1: 0
2: 0
3: 1
4: 61
Right 1186266909 X:7843018-7843040 ATGGTGCTTTGTGACGTATAAGG 0: 3
1: 3
2: 0
3: 2
4: 64
1186266899_1186266909 7 Left 1186266899 X:7842988-7843010 CCCGCCCCCGACTTCATCCGCCA 0: 6
1: 0
2: 0
3: 11
4: 137
Right 1186266909 X:7843018-7843040 ATGGTGCTTTGTGACGTATAAGG 0: 3
1: 3
2: 0
3: 2
4: 64
1186266891_1186266909 15 Left 1186266891 X:7842980-7843002 CCCCCCCCCCCGCCCCCGACTTC 0: 4
1: 3
2: 35
3: 312
4: 2473
Right 1186266909 X:7843018-7843040 ATGGTGCTTTGTGACGTATAAGG 0: 3
1: 3
2: 0
3: 2
4: 64
1186266903_1186266909 1 Left 1186266903 X:7842994-7843016 CCCGACTTCATCCGCCATGTCCT 0: 6
1: 0
2: 0
3: 7
4: 114
Right 1186266909 X:7843018-7843040 ATGGTGCTTTGTGACGTATAAGG 0: 3
1: 3
2: 0
3: 2
4: 64
1186266893_1186266909 13 Left 1186266893 X:7842982-7843004 CCCCCCCCCGCCCCCGACTTCAT 0: 6
1: 0
2: 12
3: 154
4: 2625
Right 1186266909 X:7843018-7843040 ATGGTGCTTTGTGACGTATAAGG 0: 3
1: 3
2: 0
3: 2
4: 64
1186266904_1186266909 0 Left 1186266904 X:7842995-7843017 CCGACTTCATCCGCCATGTCCTG 0: 6
1: 0
2: 0
3: 8
4: 190
Right 1186266909 X:7843018-7843040 ATGGTGCTTTGTGACGTATAAGG 0: 3
1: 3
2: 0
3: 2
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186266909 Original CRISPR ATGGTGCTTTGTGACGTATA AGG Intronic