ID: 1186266911

View in Genome Browser
Species Human (GRCh38)
Location X:7843037-7843059
Sequence AAGGCCTTCCTTCCCGCCCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 3, 1: 3, 2: 2, 3: 15, 4: 142}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186266897_1186266911 28 Left 1186266897 X:7842986-7843008 CCCCCGCCCCCGACTTCATCCGC 0: 6
1: 0
2: 1
3: 11
4: 212
Right 1186266911 X:7843037-7843059 AAGGCCTTCCTTCCCGCCCAGGG 0: 3
1: 3
2: 2
3: 15
4: 142
1186266904_1186266911 19 Left 1186266904 X:7842995-7843017 CCGACTTCATCCGCCATGTCCTG 0: 6
1: 0
2: 0
3: 8
4: 190
Right 1186266911 X:7843037-7843059 AAGGCCTTCCTTCCCGCCCAGGG 0: 3
1: 3
2: 2
3: 15
4: 142
1186266903_1186266911 20 Left 1186266903 X:7842994-7843016 CCCGACTTCATCCGCCATGTCCT 0: 6
1: 0
2: 0
3: 7
4: 114
Right 1186266911 X:7843037-7843059 AAGGCCTTCCTTCCCGCCCAGGG 0: 3
1: 3
2: 2
3: 15
4: 142
1186266900_1186266911 25 Left 1186266900 X:7842989-7843011 CCGCCCCCGACTTCATCCGCCAT 0: 6
1: 0
2: 0
3: 10
4: 97
Right 1186266911 X:7843037-7843059 AAGGCCTTCCTTCCCGCCCAGGG 0: 3
1: 3
2: 2
3: 15
4: 142
1186266901_1186266911 22 Left 1186266901 X:7842992-7843014 CCCCCGACTTCATCCGCCATGTC 0: 6
1: 0
2: 0
3: 1
4: 61
Right 1186266911 X:7843037-7843059 AAGGCCTTCCTTCCCGCCCAGGG 0: 3
1: 3
2: 2
3: 15
4: 142
1186266898_1186266911 27 Left 1186266898 X:7842987-7843009 CCCCGCCCCCGACTTCATCCGCC 0: 6
1: 0
2: 1
3: 8
4: 151
Right 1186266911 X:7843037-7843059 AAGGCCTTCCTTCCCGCCCAGGG 0: 3
1: 3
2: 2
3: 15
4: 142
1186266906_1186266911 9 Left 1186266906 X:7843005-7843027 CCGCCATGTCCTGATGGTGCTTT 0: 5
1: 1
2: 1
3: 14
4: 231
Right 1186266911 X:7843037-7843059 AAGGCCTTCCTTCCCGCCCAGGG 0: 3
1: 3
2: 2
3: 15
4: 142
1186266908_1186266911 0 Left 1186266908 X:7843014-7843036 CCTGATGGTGCTTTGTGACGTAT 0: 3
1: 3
2: 0
3: 4
4: 79
Right 1186266911 X:7843037-7843059 AAGGCCTTCCTTCCCGCCCAGGG 0: 3
1: 3
2: 2
3: 15
4: 142
1186266899_1186266911 26 Left 1186266899 X:7842988-7843010 CCCGCCCCCGACTTCATCCGCCA 0: 6
1: 0
2: 0
3: 11
4: 137
Right 1186266911 X:7843037-7843059 AAGGCCTTCCTTCCCGCCCAGGG 0: 3
1: 3
2: 2
3: 15
4: 142
1186266902_1186266911 21 Left 1186266902 X:7842993-7843015 CCCCGACTTCATCCGCCATGTCC 0: 6
1: 0
2: 0
3: 5
4: 72
Right 1186266911 X:7843037-7843059 AAGGCCTTCCTTCCCGCCCAGGG 0: 3
1: 3
2: 2
3: 15
4: 142
1186266907_1186266911 6 Left 1186266907 X:7843008-7843030 CCATGTCCTGATGGTGCTTTGTG 0: 3
1: 3
2: 0
3: 23
4: 256
Right 1186266911 X:7843037-7843059 AAGGCCTTCCTTCCCGCCCAGGG 0: 3
1: 3
2: 2
3: 15
4: 142
1186266896_1186266911 29 Left 1186266896 X:7842985-7843007 CCCCCCGCCCCCGACTTCATCCG 0: 6
1: 0
2: 0
3: 17
4: 189
Right 1186266911 X:7843037-7843059 AAGGCCTTCCTTCCCGCCCAGGG 0: 3
1: 3
2: 2
3: 15
4: 142
1186266895_1186266911 30 Left 1186266895 X:7842984-7843006 CCCCCCCGCCCCCGACTTCATCC 0: 6
1: 1
2: 6
3: 39
4: 549
Right 1186266911 X:7843037-7843059 AAGGCCTTCCTTCCCGCCCAGGG 0: 3
1: 3
2: 2
3: 15
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186266911 Original CRISPR AAGGCCTTCCTTCCCGCCCA GGG Exonic