ID: 1186266912

View in Genome Browser
Species Human (GRCh38)
Location X:7843041-7843063
Sequence GTCGCCCTGGGCGGGAAGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 2, 2: 5, 3: 19, 4: 212}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186266912_1186266924 19 Left 1186266912 X:7843041-7843063 CCTTCCTTCCCGCCCAGGGCGAC 0: 1
1: 2
2: 5
3: 19
4: 212
Right 1186266924 X:7843083-7843105 TGTTGACCAATCACAGCTCAGGG 0: 6
1: 0
2: 4
3: 16
4: 241
1186266912_1186266923 18 Left 1186266912 X:7843041-7843063 CCTTCCTTCCCGCCCAGGGCGAC 0: 1
1: 2
2: 5
3: 19
4: 212
Right 1186266923 X:7843082-7843104 GTGTTGACCAATCACAGCTCAGG 0: 6
1: 0
2: 0
3: 11
4: 96
1186266912_1186266921 -6 Left 1186266912 X:7843041-7843063 CCTTCCTTCCCGCCCAGGGCGAC 0: 1
1: 2
2: 5
3: 19
4: 212
Right 1186266921 X:7843058-7843080 GGCGACCATTGGCTGGGTAGTGG 0: 1
1: 5
2: 1
3: 8
4: 87
1186266912_1186266925 20 Left 1186266912 X:7843041-7843063 CCTTCCTTCCCGCCCAGGGCGAC 0: 1
1: 2
2: 5
3: 19
4: 212
Right 1186266925 X:7843084-7843106 GTTGACCAATCACAGCTCAGGGG 0: 6
1: 0
2: 4
3: 21
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186266912 Original CRISPR GTCGCCCTGGGCGGGAAGGA AGG (reversed) Exonic