ID: 1186266914

View in Genome Browser
Species Human (GRCh38)
Location X:7843047-7843069
Sequence TTCCCGCCCAGGGCGACCAT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 2, 2: 3, 3: 2, 4: 48}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186266906_1186266914 19 Left 1186266906 X:7843005-7843027 CCGCCATGTCCTGATGGTGCTTT 0: 5
1: 1
2: 1
3: 14
4: 231
Right 1186266914 X:7843047-7843069 TTCCCGCCCAGGGCGACCATTGG 0: 1
1: 2
2: 3
3: 2
4: 48
1186266903_1186266914 30 Left 1186266903 X:7842994-7843016 CCCGACTTCATCCGCCATGTCCT 0: 6
1: 0
2: 0
3: 7
4: 114
Right 1186266914 X:7843047-7843069 TTCCCGCCCAGGGCGACCATTGG 0: 1
1: 2
2: 3
3: 2
4: 48
1186266908_1186266914 10 Left 1186266908 X:7843014-7843036 CCTGATGGTGCTTTGTGACGTAT 0: 3
1: 3
2: 0
3: 4
4: 79
Right 1186266914 X:7843047-7843069 TTCCCGCCCAGGGCGACCATTGG 0: 1
1: 2
2: 3
3: 2
4: 48
1186266907_1186266914 16 Left 1186266907 X:7843008-7843030 CCATGTCCTGATGGTGCTTTGTG 0: 3
1: 3
2: 0
3: 23
4: 256
Right 1186266914 X:7843047-7843069 TTCCCGCCCAGGGCGACCATTGG 0: 1
1: 2
2: 3
3: 2
4: 48
1186266904_1186266914 29 Left 1186266904 X:7842995-7843017 CCGACTTCATCCGCCATGTCCTG 0: 6
1: 0
2: 0
3: 8
4: 190
Right 1186266914 X:7843047-7843069 TTCCCGCCCAGGGCGACCATTGG 0: 1
1: 2
2: 3
3: 2
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186266914 Original CRISPR TTCCCGCCCAGGGCGACCAT TGG Exonic