ID: 1186266921

View in Genome Browser
Species Human (GRCh38)
Location X:7843058-7843080
Sequence GGCGACCATTGGCTGGGTAG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 5, 2: 1, 3: 8, 4: 87}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186266913_1186266921 -10 Left 1186266913 X:7843045-7843067 CCTTCCCGCCCAGGGCGACCATT 0: 1
1: 2
2: 3
3: 7
4: 97
Right 1186266921 X:7843058-7843080 GGCGACCATTGGCTGGGTAGTGG 0: 1
1: 5
2: 1
3: 8
4: 87
1186266908_1186266921 21 Left 1186266908 X:7843014-7843036 CCTGATGGTGCTTTGTGACGTAT 0: 3
1: 3
2: 0
3: 4
4: 79
Right 1186266921 X:7843058-7843080 GGCGACCATTGGCTGGGTAGTGG 0: 1
1: 5
2: 1
3: 8
4: 87
1186266906_1186266921 30 Left 1186266906 X:7843005-7843027 CCGCCATGTCCTGATGGTGCTTT 0: 5
1: 1
2: 1
3: 14
4: 231
Right 1186266921 X:7843058-7843080 GGCGACCATTGGCTGGGTAGTGG 0: 1
1: 5
2: 1
3: 8
4: 87
1186266912_1186266921 -6 Left 1186266912 X:7843041-7843063 CCTTCCTTCCCGCCCAGGGCGAC 0: 1
1: 2
2: 5
3: 19
4: 212
Right 1186266921 X:7843058-7843080 GGCGACCATTGGCTGGGTAGTGG 0: 1
1: 5
2: 1
3: 8
4: 87
1186266907_1186266921 27 Left 1186266907 X:7843008-7843030 CCATGTCCTGATGGTGCTTTGTG 0: 3
1: 3
2: 0
3: 23
4: 256
Right 1186266921 X:7843058-7843080 GGCGACCATTGGCTGGGTAGTGG 0: 1
1: 5
2: 1
3: 8
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186266921 Original CRISPR GGCGACCATTGGCTGGGTAG TGG Exonic