ID: 1186270935

View in Genome Browser
Species Human (GRCh38)
Location X:7887230-7887252
Sequence ATGAATTTACTAGGAAGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186270931_1186270935 4 Left 1186270931 X:7887203-7887225 CCGTTATCCCAGTGGGGAAAGTG No data
Right 1186270935 X:7887230-7887252 ATGAATTTACTAGGAAGCACTGG No data
1186270932_1186270935 -3 Left 1186270932 X:7887210-7887232 CCCAGTGGGGAAAGTGAAAGATG No data
Right 1186270935 X:7887230-7887252 ATGAATTTACTAGGAAGCACTGG No data
1186270933_1186270935 -4 Left 1186270933 X:7887211-7887233 CCAGTGGGGAAAGTGAAAGATGA No data
Right 1186270935 X:7887230-7887252 ATGAATTTACTAGGAAGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186270935 Original CRISPR ATGAATTTACTAGGAAGCAC TGG Intergenic
No off target data available for this crispr