ID: 1186274786

View in Genome Browser
Species Human (GRCh38)
Location X:7927392-7927414
Sequence GACTTTCCTGGGCCGGCTCG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 74}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186274786_1186274796 11 Left 1186274786 X:7927392-7927414 CCGCGAGCCGGCCCAGGAAAGTC 0: 1
1: 0
2: 0
3: 5
4: 74
Right 1186274796 X:7927426-7927448 GTTGGTACCGCCTCCCGCGCAGG 0: 1
1: 0
2: 0
3: 0
4: 19
1186274786_1186274794 -7 Left 1186274786 X:7927392-7927414 CCGCGAGCCGGCCCAGGAAAGTC 0: 1
1: 0
2: 0
3: 5
4: 74
Right 1186274794 X:7927408-7927430 GAAAGTCCTGCGGCAGGGGTTGG 0: 1
1: 0
2: 2
3: 22
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186274786 Original CRISPR GACTTTCCTGGGCCGGCTCG CGG (reversed) Exonic
900102600 1:968231-968253 CACATTCCTGGGCCTGCTCAGGG + Intronic
900484346 1:2914384-2914406 GGCTTTCCTGGGCAAGCTGGCGG + Intergenic
900626195 1:3609790-3609812 GACCTTCCTGGGCCCGCTGCCGG - Intronic
900739002 1:4319151-4319173 GACTTGCCTGGGGGAGCTCGGGG - Intergenic
901184706 1:7365544-7365566 GACTTCCCTGGGCCTGCTGGTGG + Intronic
901919763 1:12527800-12527822 GACTTTCCAGCGCGGGCTGGAGG + Intergenic
904498944 1:30903030-30903052 GAGCTTCCTGGGCAGGCTCGTGG - Intronic
905733575 1:40311962-40311984 GAAGTTCCTGGGCCTGCTCCTGG - Intronic
915858587 1:159418326-159418348 GGGTTTCCTGGGCCAGCTCCAGG + Intergenic
915977655 1:160401147-160401169 GACTTTCCTGGGCCCGGGCGGGG + Intronic
918060417 1:181056447-181056469 GCCTTTCCTGTGCTGGCTCATGG + Exonic
1063523821 10:6764723-6764745 GACTTGGCTGGGCCGGGTCCAGG - Intergenic
1071327757 10:84534003-84534025 GGGTTTCCTGGGCCGGGTCCAGG + Intergenic
1074531674 10:114302574-114302596 GGCTTTCGTGGGCAGGCTCAGGG - Intronic
1078664453 11:13313194-13313216 GCCTCTCCTGGGTCGGCTCCCGG + Intronic
1103927792 12:124433368-124433390 GACTTTCCTCTGCTGGCTTGAGG - Intronic
1113750571 13:112773895-112773917 GACTTCCCTGGGAAGGCACGAGG - Intronic
1113799999 13:113081316-113081338 GACTCCCCTGGGCCAGCTGGTGG + Intronic
1117285479 14:54282538-54282560 GCTTTTCCTGGGCCTGCTCATGG - Intergenic
1119164478 14:72480791-72480813 GGCTTCCCTGGGCCTGCTCCAGG + Intronic
1120764380 14:88315279-88315301 GACTAACCTGGGCCAGCTCCTGG - Intronic
1126097105 15:45097585-45097607 GACTTCCCTGGGCCAGCCCATGG - Intronic
1127531709 15:59850046-59850068 GACCTTCCTGGGGCAGCTCTTGG + Intergenic
1131175056 15:90204138-90204160 GCCCATCCTGGGCAGGCTCGTGG + Intronic
1131960790 15:97788375-97788397 GACTTTCCAGGGCCACCTTGCGG - Intergenic
1136363434 16:29796809-29796831 AACTTTGCTGGGCGGGCTGGGGG - Intronic
1137716851 16:50603410-50603432 GAATTTCCTGGGGCAGCTCCAGG + Intronic
1138506417 16:57480448-57480470 GAATGTGCTGGGCCGGCTGGAGG + Intronic
1145971355 17:28958246-28958268 GACTGTCCTGGGCGGGCTCAGGG + Intronic
1157707281 18:49818113-49818135 GACATTCCTGGGCGGGGTGGGGG + Intronic
1158205281 18:54985997-54986019 GAATTTCCTGGCCAGGCTCGTGG + Intergenic
1159559982 18:69983728-69983750 GACTTTCCGGGGCTGCCTGGAGG - Intergenic
1159560078 18:69984261-69984283 GACTTTCCGGGGCTGCCTGGAGG + Intergenic
1160204704 18:76822882-76822904 TACTTTCCTGGGCCGGGCGGCGG + Intronic
1163726323 19:18925020-18925042 GAATTTGCTGGGCAGGCTGGAGG - Intronic
1164917740 19:32065664-32065686 GAGGTTCCTGGGCCCGCTCATGG - Intergenic
1166916629 19:46199736-46199758 GCATTTCCTGGGATGGCTCGAGG - Intergenic
926935592 2:18084256-18084278 GAGGTTCCTGGGTGGGCTCGGGG + Intronic
929492461 2:42408341-42408363 GCCTTTTCTGGGCCCGCTCATGG + Intronic
931616821 2:64167757-64167779 GTCATTCCTGGGCTGGCTCTAGG - Intergenic
934708314 2:96499901-96499923 GGCATTCCTGGGCCGGGTGGTGG - Intronic
938096410 2:128467081-128467103 GTCTTTCCTGGGCCCGCCCATGG - Intergenic
944505881 2:200410324-200410346 GACCTTCCTGGGCTGGATGGAGG + Intronic
947327260 2:228992424-228992446 GACTTTTCTGGGCCTGATCATGG - Intronic
947713355 2:232328254-232328276 GACTTTTTTGGGCTGGCTCATGG - Intronic
1170043864 20:12065577-12065599 GCCTTTTCTGGGCCTGCCCGTGG - Intergenic
1170153598 20:13249973-13249995 GACTTTCTTGGGCCTCCTCCTGG - Intronic
1173503449 20:43569536-43569558 GGCTTCCCTGGGCTGGCTCTCGG + Intronic
1175034469 20:55987072-55987094 GACTTTCCTGGCCATCCTCGGGG + Intergenic
1175607005 20:60319335-60319357 GACTGTGCTGGGGCGGCTGGCGG - Intergenic
1179193309 21:39141860-39141882 GGCCTTCCTGGGCTGGCTCAGGG + Intergenic
1181726542 22:24814978-24815000 GACTTTCCTGGCCCTGCACTTGG + Intronic
1182492225 22:30680899-30680921 GACTTTGCTGGCCAGGCACGTGG - Intergenic
1183201594 22:36388374-36388396 GCCTTGCCTGGGCCGGGGCGAGG + Intergenic
1184766818 22:46576661-46576683 GCCTTTCCTCGACCGCCTCGCGG - Intronic
953632299 3:44629330-44629352 GAGTTCCCTGAGCCGGCTCAGGG - Exonic
960151566 3:114253897-114253919 GACTCTCATGGGGCGGCTAGAGG - Intergenic
984887687 4:184465231-184465253 GGCTTTCCTGGCCAGGCTCTTGG - Intronic
995451998 5:112312519-112312541 GACTCTCCTGGCCCTGCTCCAGG - Intronic
995831595 5:116361149-116361171 GGCTTCCCTGCGCCGGCTCTGGG - Intronic
998156259 5:139788633-139788655 GACTCTCCTGGACAGGCTCCCGG + Intergenic
1004096484 6:12560144-12560166 GCCTTTCCTGGGCCGAATCCAGG + Intergenic
1004223553 6:13767214-13767236 GTCTTTTCTGGGCCGGCCCCAGG + Intergenic
1006928568 6:37673476-37673498 GGCTTTCCTGGGCAGGCACCTGG + Intronic
1016259223 6:142147516-142147538 GAGTTCCCTGGGTAGGCTCGAGG - Intronic
1019026093 6:168964196-168964218 GCCTTTCCTGACCCGGCTCCTGG + Intergenic
1019437105 7:1028037-1028059 GACCGTCCAGGGCCTGCTCGGGG + Intronic
1021046162 7:15925323-15925345 GACATTTCTGGACCGGCTCTGGG + Intergenic
1022815708 7:33912311-33912333 GATTTTCCTGGCCCGCCTTGTGG + Intronic
1024531940 7:50400653-50400675 GCTTTTCCTGGGGTGGCTCGGGG - Exonic
1032574624 7:133040222-133040244 GACTTTCCTGGGGCAGCTATAGG - Intronic
1035707690 8:1689693-1689715 GTCTTTCCTGAGCTGGCTCACGG - Intronic
1036504040 8:9339208-9339230 GATTTTCCTGGGCCACCTTGAGG + Intergenic
1042196825 8:66238213-66238235 GCCTTTTCTGGGCCTGCTCATGG - Intergenic
1045114948 8:98972461-98972483 CACTTTCCGGCGCCGGCTCATGG + Intergenic
1045430890 8:102114256-102114278 GACTCTGCTGGGCCAGCTCCTGG - Intronic
1049960569 9:734327-734349 GACCTGCCTGGGCTGGCTTGGGG + Intronic
1050042955 9:1514791-1514813 GACATTCCTGGGCAGGGTGGTGG + Intergenic
1186274786 X:7927392-7927414 GACTTTCCTGGGCCGGCTCGCGG - Exonic
1196670335 X:118359411-118359433 CACTTTCCTGGGCCTACTCAAGG - Intronic