ID: 1186290611

View in Genome Browser
Species Human (GRCh38)
Location X:8093710-8093732
Sequence GAGGAGCCTGCAGTTTGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186290608_1186290611 22 Left 1186290608 X:8093665-8093687 CCACTTGGACAGGAAGGGATTGT No data
Right 1186290611 X:8093710-8093732 GAGGAGCCTGCAGTTTGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186290611 Original CRISPR GAGGAGCCTGCAGTTTGCTG TGG Intergenic
No off target data available for this crispr