ID: 1186294729

View in Genome Browser
Species Human (GRCh38)
Location X:8136573-8136595
Sequence GTGACAGACCACATATTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186294728_1186294729 -1 Left 1186294728 X:8136551-8136573 CCACATAAGAATATTTCAGTCAG No data
Right 1186294729 X:8136573-8136595 GTGACAGACCACATATTTGATGG No data
1186294727_1186294729 5 Left 1186294727 X:8136545-8136567 CCTGCACCACATAAGAATATTTC No data
Right 1186294729 X:8136573-8136595 GTGACAGACCACATATTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186294729 Original CRISPR GTGACAGACCACATATTTGA TGG Intergenic
No off target data available for this crispr