ID: 1186295177

View in Genome Browser
Species Human (GRCh38)
Location X:8141442-8141464
Sequence CCCATATTTGGTGTAAAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186295177_1186295181 -3 Left 1186295177 X:8141442-8141464 CCCAGTTTTACACCAAATATGGG No data
Right 1186295181 X:8141462-8141484 GGGTGTTCCCAGATCTGTCATGG No data
1186295177_1186295184 6 Left 1186295177 X:8141442-8141464 CCCAGTTTTACACCAAATATGGG No data
Right 1186295184 X:8141471-8141493 CAGATCTGTCATGGTGCTTGTGG No data
1186295177_1186295185 7 Left 1186295177 X:8141442-8141464 CCCAGTTTTACACCAAATATGGG No data
Right 1186295185 X:8141472-8141494 AGATCTGTCATGGTGCTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186295177 Original CRISPR CCCATATTTGGTGTAAAACT GGG (reversed) Intergenic
No off target data available for this crispr