ID: 1186295181

View in Genome Browser
Species Human (GRCh38)
Location X:8141462-8141484
Sequence GGGTGTTCCCAGATCTGTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186295175_1186295181 0 Left 1186295175 X:8141439-8141461 CCACCCAGTTTTACACCAAATAT No data
Right 1186295181 X:8141462-8141484 GGGTGTTCCCAGATCTGTCATGG No data
1186295179_1186295181 -4 Left 1186295179 X:8141443-8141465 CCAGTTTTACACCAAATATGGGT No data
Right 1186295181 X:8141462-8141484 GGGTGTTCCCAGATCTGTCATGG No data
1186295177_1186295181 -3 Left 1186295177 X:8141442-8141464 CCCAGTTTTACACCAAATATGGG No data
Right 1186295181 X:8141462-8141484 GGGTGTTCCCAGATCTGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186295181 Original CRISPR GGGTGTTCCCAGATCTGTCA TGG Intergenic
No off target data available for this crispr