ID: 1186295581

View in Genome Browser
Species Human (GRCh38)
Location X:8144909-8144931
Sequence GGCCCCAGTGCAGGATCCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186295581_1186295586 8 Left 1186295581 X:8144909-8144931 CCGGTGGATCCTGCACTGGGGCC No data
Right 1186295586 X:8144940-8144962 AGCTGCCTGCCAGTCCCACGCGG No data
1186295581_1186295588 16 Left 1186295581 X:8144909-8144931 CCGGTGGATCCTGCACTGGGGCC No data
Right 1186295588 X:8144948-8144970 GCCAGTCCCACGCGGTGCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186295581 Original CRISPR GGCCCCAGTGCAGGATCCAC CGG (reversed) Intergenic
No off target data available for this crispr