ID: 1186298897

View in Genome Browser
Species Human (GRCh38)
Location X:8177649-8177671
Sequence AACATTACAGGTTAGATCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186298891_1186298897 17 Left 1186298891 X:8177609-8177631 CCTCTGAATCTATAAGGGGAGTA No data
Right 1186298897 X:8177649-8177671 AACATTACAGGTTAGATCTATGG No data
1186298895_1186298897 -7 Left 1186298895 X:8177633-8177655 CCTGGAGGTCTGGTCTAACATTA No data
Right 1186298897 X:8177649-8177671 AACATTACAGGTTAGATCTATGG No data
1186298887_1186298897 25 Left 1186298887 X:8177601-8177623 CCGTGTGGCCTCTGAATCTATAA No data
Right 1186298897 X:8177649-8177671 AACATTACAGGTTAGATCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186298897 Original CRISPR AACATTACAGGTTAGATCTA TGG Intergenic
No off target data available for this crispr