ID: 1186300045

View in Genome Browser
Species Human (GRCh38)
Location X:8190665-8190687
Sequence CTATGAACTCAGTGTGACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186300042_1186300045 15 Left 1186300042 X:8190627-8190649 CCATTTCACGAGACTGAATTTTT No data
Right 1186300045 X:8190665-8190687 CTATGAACTCAGTGTGACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186300045 Original CRISPR CTATGAACTCAGTGTGACCT TGG Intergenic
No off target data available for this crispr