ID: 1186300673

View in Genome Browser
Species Human (GRCh38)
Location X:8196938-8196960
Sequence GCTCTCTGCCACGGGGTCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186300673_1186300682 20 Left 1186300673 X:8196938-8196960 CCTAGGACCCCGTGGCAGAGAGC No data
Right 1186300682 X:8196981-8197003 ATCACAGCATCCTCGGCGGGTGG No data
1186300673_1186300680 16 Left 1186300673 X:8196938-8196960 CCTAGGACCCCGTGGCAGAGAGC No data
Right 1186300680 X:8196977-8196999 TCATATCACAGCATCCTCGGCGG No data
1186300673_1186300681 17 Left 1186300673 X:8196938-8196960 CCTAGGACCCCGTGGCAGAGAGC No data
Right 1186300681 X:8196978-8197000 CATATCACAGCATCCTCGGCGGG No data
1186300673_1186300683 24 Left 1186300673 X:8196938-8196960 CCTAGGACCCCGTGGCAGAGAGC No data
Right 1186300683 X:8196985-8197007 CAGCATCCTCGGCGGGTGGCCGG No data
1186300673_1186300679 13 Left 1186300673 X:8196938-8196960 CCTAGGACCCCGTGGCAGAGAGC No data
Right 1186300679 X:8196974-8196996 CAATCATATCACAGCATCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186300673 Original CRISPR GCTCTCTGCCACGGGGTCCT AGG (reversed) Intergenic