ID: 1186304451

View in Genome Browser
Species Human (GRCh38)
Location X:8240647-8240669
Sequence CTTTAAATTTCAATGGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186304451_1186304456 18 Left 1186304451 X:8240647-8240669 CCTTGCACCATTGAAATTTAAAG No data
Right 1186304456 X:8240688-8240710 CCGTGCAAGAGGGCCTCAGATGG No data
1186304451_1186304457 22 Left 1186304451 X:8240647-8240669 CCTTGCACCATTGAAATTTAAAG No data
Right 1186304457 X:8240692-8240714 GCAAGAGGGCCTCAGATGGTCGG No data
1186304451_1186304453 7 Left 1186304451 X:8240647-8240669 CCTTGCACCATTGAAATTTAAAG No data
Right 1186304453 X:8240677-8240699 AGACACTCATACCGTGCAAGAGG No data
1186304451_1186304454 8 Left 1186304451 X:8240647-8240669 CCTTGCACCATTGAAATTTAAAG No data
Right 1186304454 X:8240678-8240700 GACACTCATACCGTGCAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186304451 Original CRISPR CTTTAAATTTCAATGGTGCA AGG (reversed) Intergenic
No off target data available for this crispr