ID: 1186305660

View in Genome Browser
Species Human (GRCh38)
Location X:8254620-8254642
Sequence CTGAGTCAGTAGTTTTATCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186305660_1186305661 -1 Left 1186305660 X:8254620-8254642 CCGAGATAAAACTACTGACTCAG No data
Right 1186305661 X:8254642-8254664 GAAAGATGCATACCACGTACTGG No data
1186305660_1186305663 24 Left 1186305660 X:8254620-8254642 CCGAGATAAAACTACTGACTCAG No data
Right 1186305663 X:8254667-8254689 TTATAAATGTCATTTCTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186305660 Original CRISPR CTGAGTCAGTAGTTTTATCT CGG (reversed) Intergenic
No off target data available for this crispr