ID: 1186307058

View in Genome Browser
Species Human (GRCh38)
Location X:8273245-8273267
Sequence ATGCTCTCCATGGGCAAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186307058_1186307062 22 Left 1186307058 X:8273245-8273267 CCAGTCTTGCCCATGGAGAGCAT No data
Right 1186307062 X:8273290-8273312 TGCATAAAACATTCCTGACTTGG No data
1186307058_1186307064 29 Left 1186307058 X:8273245-8273267 CCAGTCTTGCCCATGGAGAGCAT No data
Right 1186307064 X:8273297-8273319 AACATTCCTGACTTGGGTCCAGG No data
1186307058_1186307063 23 Left 1186307058 X:8273245-8273267 CCAGTCTTGCCCATGGAGAGCAT No data
Right 1186307063 X:8273291-8273313 GCATAAAACATTCCTGACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186307058 Original CRISPR ATGCTCTCCATGGGCAAGAC TGG (reversed) Intergenic
No off target data available for this crispr