ID: 1186307385

View in Genome Browser
Species Human (GRCh38)
Location X:8277049-8277071
Sequence CACTGGGAAGAGAGAGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186307381_1186307385 -6 Left 1186307381 X:8277032-8277054 CCTAAATAGATAACAGACACTGG No data
Right 1186307385 X:8277049-8277071 CACTGGGAAGAGAGAGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186307385 Original CRISPR CACTGGGAAGAGAGAGAAGT GGG Intergenic
No off target data available for this crispr