ID: 1186309475

View in Genome Browser
Species Human (GRCh38)
Location X:8302150-8302172
Sequence CTCTGGAAGGGCATGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186309466_1186309475 13 Left 1186309466 X:8302114-8302136 CCTTTTCCATTGTCCATGTAACT No data
Right 1186309475 X:8302150-8302172 CTCTGGAAGGGCATGGTGGATGG No data
1186309465_1186309475 14 Left 1186309465 X:8302113-8302135 CCCTTTTCCATTGTCCATGTAAC No data
Right 1186309475 X:8302150-8302172 CTCTGGAAGGGCATGGTGGATGG No data
1186309468_1186309475 7 Left 1186309468 X:8302120-8302142 CCATTGTCCATGTAACTAAGGAA No data
Right 1186309475 X:8302150-8302172 CTCTGGAAGGGCATGGTGGATGG No data
1186309469_1186309475 0 Left 1186309469 X:8302127-8302149 CCATGTAACTAAGGAAAAACATA No data
Right 1186309475 X:8302150-8302172 CTCTGGAAGGGCATGGTGGATGG No data
1186309464_1186309475 21 Left 1186309464 X:8302106-8302128 CCTGGTGCCCTTTTCCATTGTCC No data
Right 1186309475 X:8302150-8302172 CTCTGGAAGGGCATGGTGGATGG No data
1186309463_1186309475 27 Left 1186309463 X:8302100-8302122 CCTCAGCCTGGTGCCCTTTTCCA No data
Right 1186309475 X:8302150-8302172 CTCTGGAAGGGCATGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186309475 Original CRISPR CTCTGGAAGGGCATGGTGGA TGG Intergenic
No off target data available for this crispr