ID: 1186311266

View in Genome Browser
Species Human (GRCh38)
Location X:8322417-8322439
Sequence GGGGAGTCAAAAATTATAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186311266_1186311270 12 Left 1186311266 X:8322417-8322439 CCATTTATAATTTTTGACTCCCC No data
Right 1186311270 X:8322452-8322474 ACTAATACCCTGCTGTTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186311266 Original CRISPR GGGGAGTCAAAAATTATAAA TGG (reversed) Intergenic
No off target data available for this crispr