ID: 1186311267

View in Genome Browser
Species Human (GRCh38)
Location X:8322436-8322458
Sequence TATTAGTAGTTAAGTTTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2056
Summary {0: 71, 1: 314, 2: 487, 3: 492, 4: 692}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186311267_1186311270 -7 Left 1186311267 X:8322436-8322458 CCCCAAAAACTTAACTACTAATA 0: 71
1: 314
2: 487
3: 492
4: 692
Right 1186311270 X:8322452-8322474 ACTAATACCCTGCTGTTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186311267 Original CRISPR TATTAGTAGTTAAGTTTTTG GGG (reversed) Intergenic
Too many off-targets to display for this crispr