ID: 1186311268

View in Genome Browser
Species Human (GRCh38)
Location X:8322437-8322459
Sequence GTATTAGTAGTTAAGTTTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186311268_1186311270 -8 Left 1186311268 X:8322437-8322459 CCCAAAAACTTAACTACTAATAC No data
Right 1186311270 X:8322452-8322474 ACTAATACCCTGCTGTTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186311268 Original CRISPR GTATTAGTAGTTAAGTTTTT GGG (reversed) Intergenic
No off target data available for this crispr