ID: 1186311270

View in Genome Browser
Species Human (GRCh38)
Location X:8322452-8322474
Sequence ACTAATACCCTGCTGTTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186311268_1186311270 -8 Left 1186311268 X:8322437-8322459 CCCAAAAACTTAACTACTAATAC No data
Right 1186311270 X:8322452-8322474 ACTAATACCCTGCTGTTGACAGG No data
1186311269_1186311270 -9 Left 1186311269 X:8322438-8322460 CCAAAAACTTAACTACTAATACC No data
Right 1186311270 X:8322452-8322474 ACTAATACCCTGCTGTTGACAGG No data
1186311265_1186311270 28 Left 1186311265 X:8322401-8322423 CCTTCTGCAGTCAAATCCATTTA No data
Right 1186311270 X:8322452-8322474 ACTAATACCCTGCTGTTGACAGG No data
1186311266_1186311270 12 Left 1186311266 X:8322417-8322439 CCATTTATAATTTTTGACTCCCC No data
Right 1186311270 X:8322452-8322474 ACTAATACCCTGCTGTTGACAGG No data
1186311267_1186311270 -7 Left 1186311267 X:8322436-8322458 CCCCAAAAACTTAACTACTAATA 0: 71
1: 314
2: 487
3: 492
4: 692
Right 1186311270 X:8322452-8322474 ACTAATACCCTGCTGTTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186311270 Original CRISPR ACTAATACCCTGCTGTTGAC AGG Intergenic
No off target data available for this crispr