ID: 1186315144

View in Genome Browser
Species Human (GRCh38)
Location X:8361491-8361513
Sequence TCTTATCTTTAGAAATTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186315144_1186315150 30 Left 1186315144 X:8361491-8361513 CCATAAAATTTCTAAAGATAAGA No data
Right 1186315150 X:8361544-8361566 TAAATATGATGCTAATACTATGG No data
1186315144_1186315145 -8 Left 1186315144 X:8361491-8361513 CCATAAAATTTCTAAAGATAAGA No data
Right 1186315145 X:8361506-8361528 AGATAAGAATCAGCCCCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186315144 Original CRISPR TCTTATCTTTAGAAATTTTA TGG (reversed) Intergenic
No off target data available for this crispr