ID: 1186315145

View in Genome Browser
Species Human (GRCh38)
Location X:8361506-8361528
Sequence AGATAAGAATCAGCCCCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186315142_1186315145 4 Left 1186315142 X:8361479-8361501 CCAAAATAGCTCCCATAAAATTT No data
Right 1186315145 X:8361506-8361528 AGATAAGAATCAGCCCCAGATGG No data
1186315144_1186315145 -8 Left 1186315144 X:8361491-8361513 CCATAAAATTTCTAAAGATAAGA No data
Right 1186315145 X:8361506-8361528 AGATAAGAATCAGCCCCAGATGG No data
1186315141_1186315145 14 Left 1186315141 X:8361469-8361491 CCAAGCAGAGCCAAAATAGCTCC No data
Right 1186315145 X:8361506-8361528 AGATAAGAATCAGCCCCAGATGG No data
1186315139_1186315145 25 Left 1186315139 X:8361458-8361480 CCAAAACTTTCCCAAGCAGAGCC No data
Right 1186315145 X:8361506-8361528 AGATAAGAATCAGCCCCAGATGG No data
1186315143_1186315145 -7 Left 1186315143 X:8361490-8361512 CCCATAAAATTTCTAAAGATAAG No data
Right 1186315145 X:8361506-8361528 AGATAAGAATCAGCCCCAGATGG No data
1186315140_1186315145 15 Left 1186315140 X:8361468-8361490 CCCAAGCAGAGCCAAAATAGCTC No data
Right 1186315145 X:8361506-8361528 AGATAAGAATCAGCCCCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186315145 Original CRISPR AGATAAGAATCAGCCCCAGA TGG Intergenic
No off target data available for this crispr