ID: 1186315150 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | X:8361544-8361566 |
Sequence | TAAATATGATGCTAATACTA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 5 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1186315146_1186315150 | 2 | Left | 1186315146 | X:8361519-8361541 | CCCCAGATGGTCCAGACTGAAAT | No data | ||
Right | 1186315150 | X:8361544-8361566 | TAAATATGATGCTAATACTATGG | No data | ||||
1186315148_1186315150 | 0 | Left | 1186315148 | X:8361521-8361543 | CCAGATGGTCCAGACTGAAATGT | No data | ||
Right | 1186315150 | X:8361544-8361566 | TAAATATGATGCTAATACTATGG | No data | ||||
1186315149_1186315150 | -9 | Left | 1186315149 | X:8361530-8361552 | CCAGACTGAAATGTTAAATATGA | No data | ||
Right | 1186315150 | X:8361544-8361566 | TAAATATGATGCTAATACTATGG | No data | ||||
1186315144_1186315150 | 30 | Left | 1186315144 | X:8361491-8361513 | CCATAAAATTTCTAAAGATAAGA | No data | ||
Right | 1186315150 | X:8361544-8361566 | TAAATATGATGCTAATACTATGG | No data | ||||
1186315147_1186315150 | 1 | Left | 1186315147 | X:8361520-8361542 | CCCAGATGGTCCAGACTGAAATG | No data | ||
Right | 1186315150 | X:8361544-8361566 | TAAATATGATGCTAATACTATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1186315150 | Original CRISPR | TAAATATGATGCTAATACTA TGG | Intergenic | ||
No off target data available for this crispr |