ID: 1186315150

View in Genome Browser
Species Human (GRCh38)
Location X:8361544-8361566
Sequence TAAATATGATGCTAATACTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186315146_1186315150 2 Left 1186315146 X:8361519-8361541 CCCCAGATGGTCCAGACTGAAAT No data
Right 1186315150 X:8361544-8361566 TAAATATGATGCTAATACTATGG No data
1186315148_1186315150 0 Left 1186315148 X:8361521-8361543 CCAGATGGTCCAGACTGAAATGT No data
Right 1186315150 X:8361544-8361566 TAAATATGATGCTAATACTATGG No data
1186315149_1186315150 -9 Left 1186315149 X:8361530-8361552 CCAGACTGAAATGTTAAATATGA No data
Right 1186315150 X:8361544-8361566 TAAATATGATGCTAATACTATGG No data
1186315144_1186315150 30 Left 1186315144 X:8361491-8361513 CCATAAAATTTCTAAAGATAAGA No data
Right 1186315150 X:8361544-8361566 TAAATATGATGCTAATACTATGG No data
1186315147_1186315150 1 Left 1186315147 X:8361520-8361542 CCCAGATGGTCCAGACTGAAATG No data
Right 1186315150 X:8361544-8361566 TAAATATGATGCTAATACTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186315150 Original CRISPR TAAATATGATGCTAATACTA TGG Intergenic
No off target data available for this crispr