ID: 1186318894

View in Genome Browser
Species Human (GRCh38)
Location X:8402260-8402282
Sequence GCAGCCATTAAGTCTAAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186318894_1186318898 -3 Left 1186318894 X:8402260-8402282 CCCCCTTTAGACTTAATGGCTGC No data
Right 1186318898 X:8402280-8402302 TGCCATTCCTCTATATCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186318894 Original CRISPR GCAGCCATTAAGTCTAAAGG GGG (reversed) Intergenic
No off target data available for this crispr