ID: 1186324593 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | X:8465236-8465258 |
Sequence | ATGGCGGATGAAGTCGGGGG CGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 113 | |||
Summary | {0: 6, 1: 0, 2: 0, 3: 10, 4: 97} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1186324593_1186324604 | 25 | Left | 1186324593 | X:8465236-8465258 | CCGCCCCCGACTTCATCCGCCAT | 0: 6 1: 0 2: 0 3: 10 4: 97 |
||
Right | 1186324604 | X:8465284-8465306 | AAGGCCTTCCTTCCCGCCCAGGG | 0: 3 1: 3 2: 2 3: 15 4: 142 |
||||
1186324593_1186324603 | 24 | Left | 1186324593 | X:8465236-8465258 | CCGCCCCCGACTTCATCCGCCAT | 0: 6 1: 0 2: 0 3: 10 4: 97 |
||
Right | 1186324603 | X:8465283-8465305 | TAAGGCCTTCCTTCCCGCCCAGG | 0: 3 1: 3 2: 0 3: 18 4: 122 |
||||
1186324593_1186324602 | 6 | Left | 1186324593 | X:8465236-8465258 | CCGCCCCCGACTTCATCCGCCAT | 0: 6 1: 0 2: 0 3: 10 4: 97 |
||
Right | 1186324602 | X:8465265-8465287 | ATGGTGCTTTGTGACGTATAAGG | 0: 3 1: 3 2: 0 3: 2 4: 64 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1186324593 | Original CRISPR | ATGGCGGATGAAGTCGGGGG CGG (reversed) | Intronic | ||