ID: 1186324596

View in Genome Browser
Species Human (GRCh38)
Location X:8465241-8465263
Sequence AGGACATGGCGGATGAAGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 6, 1: 0, 2: 0, 3: 7, 4: 114}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186324596_1186324604 20 Left 1186324596 X:8465241-8465263 CCCGACTTCATCCGCCATGTCCT 0: 6
1: 0
2: 0
3: 7
4: 114
Right 1186324604 X:8465284-8465306 AAGGCCTTCCTTCCCGCCCAGGG 0: 3
1: 3
2: 2
3: 15
4: 142
1186324596_1186324602 1 Left 1186324596 X:8465241-8465263 CCCGACTTCATCCGCCATGTCCT 0: 6
1: 0
2: 0
3: 7
4: 114
Right 1186324602 X:8465265-8465287 ATGGTGCTTTGTGACGTATAAGG 0: 3
1: 3
2: 0
3: 2
4: 64
1186324596_1186324607 30 Left 1186324596 X:8465241-8465263 CCCGACTTCATCCGCCATGTCCT 0: 6
1: 0
2: 0
3: 7
4: 114
Right 1186324607 X:8465294-8465316 TTCCCGCCCAGGGCTACCATTGG 0: 2
1: 4
2: 1
3: 5
4: 68
1186324596_1186324603 19 Left 1186324596 X:8465241-8465263 CCCGACTTCATCCGCCATGTCCT 0: 6
1: 0
2: 0
3: 7
4: 114
Right 1186324603 X:8465283-8465305 TAAGGCCTTCCTTCCCGCCCAGG 0: 3
1: 3
2: 0
3: 18
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186324596 Original CRISPR AGGACATGGCGGATGAAGTC GGG (reversed) Intronic