ID: 1186324600

View in Genome Browser
Species Human (GRCh38)
Location X:8465255-8465277
Sequence CACAAAGCACCATCAGGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 3, 1: 3, 2: 0, 3: 23, 4: 256}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186324600_1186324610 20 Left 1186324600 X:8465255-8465277 CCATGTCCTGATGGTGCTTTGTG 0: 3
1: 3
2: 0
3: 23
4: 256
Right 1186324610 X:8465298-8465320 CGCCCAGGGCTACCATTGGCTGG 0: 2
1: 4
2: 3
3: 6
4: 84
1186324600_1186324611 21 Left 1186324600 X:8465255-8465277 CCATGTCCTGATGGTGCTTTGTG 0: 3
1: 3
2: 0
3: 23
4: 256
Right 1186324611 X:8465299-8465321 GCCCAGGGCTACCATTGGCTGGG 0: 2
1: 4
2: 3
3: 20
4: 241
1186324600_1186324614 27 Left 1186324600 X:8465255-8465277 CCATGTCCTGATGGTGCTTTGTG 0: 3
1: 3
2: 0
3: 23
4: 256
Right 1186324614 X:8465305-8465327 GGCTACCATTGGCTGGGTAGTGG 0: 5
1: 1
2: 3
3: 21
4: 338
1186324600_1186324604 6 Left 1186324600 X:8465255-8465277 CCATGTCCTGATGGTGCTTTGTG 0: 3
1: 3
2: 0
3: 23
4: 256
Right 1186324604 X:8465284-8465306 AAGGCCTTCCTTCCCGCCCAGGG 0: 3
1: 3
2: 2
3: 15
4: 142
1186324600_1186324603 5 Left 1186324600 X:8465255-8465277 CCATGTCCTGATGGTGCTTTGTG 0: 3
1: 3
2: 0
3: 23
4: 256
Right 1186324603 X:8465283-8465305 TAAGGCCTTCCTTCCCGCCCAGG 0: 3
1: 3
2: 0
3: 18
4: 122
1186324600_1186324607 16 Left 1186324600 X:8465255-8465277 CCATGTCCTGATGGTGCTTTGTG 0: 3
1: 3
2: 0
3: 23
4: 256
Right 1186324607 X:8465294-8465316 TTCCCGCCCAGGGCTACCATTGG 0: 2
1: 4
2: 1
3: 5
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186324600 Original CRISPR CACAAAGCACCATCAGGACA TGG (reversed) Intronic