ID: 1186324602

View in Genome Browser
Species Human (GRCh38)
Location X:8465265-8465287
Sequence ATGGTGCTTTGTGACGTATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 3, 1: 3, 2: 0, 3: 2, 4: 64}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186324596_1186324602 1 Left 1186324596 X:8465241-8465263 CCCGACTTCATCCGCCATGTCCT 0: 6
1: 0
2: 0
3: 7
4: 114
Right 1186324602 X:8465265-8465287 ATGGTGCTTTGTGACGTATAAGG 0: 3
1: 3
2: 0
3: 2
4: 64
1186324591_1186324602 8 Left 1186324591 X:8465234-8465256 CCCCGCCCCCGACTTCATCCGCC 0: 6
1: 0
2: 1
3: 8
4: 151
Right 1186324602 X:8465265-8465287 ATGGTGCTTTGTGACGTATAAGG 0: 3
1: 3
2: 0
3: 2
4: 64
1186324586_1186324602 13 Left 1186324586 X:8465229-8465251 CCCCCCCCCGCCCCCGACTTCAT 0: 6
1: 0
2: 12
3: 154
4: 2625
Right 1186324602 X:8465265-8465287 ATGGTGCTTTGTGACGTATAAGG 0: 3
1: 3
2: 0
3: 2
4: 64
1186324593_1186324602 6 Left 1186324593 X:8465236-8465258 CCGCCCCCGACTTCATCCGCCAT 0: 6
1: 0
2: 0
3: 10
4: 97
Right 1186324602 X:8465265-8465287 ATGGTGCTTTGTGACGTATAAGG 0: 3
1: 3
2: 0
3: 2
4: 64
1186324597_1186324602 0 Left 1186324597 X:8465242-8465264 CCGACTTCATCCGCCATGTCCTG 0: 6
1: 0
2: 0
3: 8
4: 190
Right 1186324602 X:8465265-8465287 ATGGTGCTTTGTGACGTATAAGG 0: 3
1: 3
2: 0
3: 2
4: 64
1186324588_1186324602 11 Left 1186324588 X:8465231-8465253 CCCCCCCGCCCCCGACTTCATCC 0: 6
1: 1
2: 6
3: 39
4: 549
Right 1186324602 X:8465265-8465287 ATGGTGCTTTGTGACGTATAAGG 0: 3
1: 3
2: 0
3: 2
4: 64
1186324590_1186324602 9 Left 1186324590 X:8465233-8465255 CCCCCGCCCCCGACTTCATCCGC 0: 6
1: 0
2: 1
3: 11
4: 212
Right 1186324602 X:8465265-8465287 ATGGTGCTTTGTGACGTATAAGG 0: 3
1: 3
2: 0
3: 2
4: 64
1186324585_1186324602 28 Left 1186324585 X:8465214-8465236 CCTCATTAGATGTCACCCCCCCC 0: 4
1: 2
2: 0
3: 7
4: 99
Right 1186324602 X:8465265-8465287 ATGGTGCTTTGTGACGTATAAGG 0: 3
1: 3
2: 0
3: 2
4: 64
1186324599_1186324602 -10 Left 1186324599 X:8465252-8465274 CCGCCATGTCCTGATGGTGCTTT 0: 5
1: 1
2: 1
3: 14
4: 231
Right 1186324602 X:8465265-8465287 ATGGTGCTTTGTGACGTATAAGG 0: 3
1: 3
2: 0
3: 2
4: 64
1186324589_1186324602 10 Left 1186324589 X:8465232-8465254 CCCCCCGCCCCCGACTTCATCCG 0: 6
1: 0
2: 0
3: 17
4: 189
Right 1186324602 X:8465265-8465287 ATGGTGCTTTGTGACGTATAAGG 0: 3
1: 3
2: 0
3: 2
4: 64
1186324595_1186324602 2 Left 1186324595 X:8465240-8465262 CCCCGACTTCATCCGCCATGTCC 0: 6
1: 0
2: 0
3: 5
4: 72
Right 1186324602 X:8465265-8465287 ATGGTGCTTTGTGACGTATAAGG 0: 3
1: 3
2: 0
3: 2
4: 64
1186324594_1186324602 3 Left 1186324594 X:8465239-8465261 CCCCCGACTTCATCCGCCATGTC 0: 6
1: 0
2: 0
3: 1
4: 61
Right 1186324602 X:8465265-8465287 ATGGTGCTTTGTGACGTATAAGG 0: 3
1: 3
2: 0
3: 2
4: 64
1186324592_1186324602 7 Left 1186324592 X:8465235-8465257 CCCGCCCCCGACTTCATCCGCCA 0: 6
1: 0
2: 0
3: 11
4: 137
Right 1186324602 X:8465265-8465287 ATGGTGCTTTGTGACGTATAAGG 0: 3
1: 3
2: 0
3: 2
4: 64
1186324587_1186324602 12 Left 1186324587 X:8465230-8465252 CCCCCCCCGCCCCCGACTTCATC 0: 6
1: 0
2: 4
3: 62
4: 650
Right 1186324602 X:8465265-8465287 ATGGTGCTTTGTGACGTATAAGG 0: 3
1: 3
2: 0
3: 2
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186324602 Original CRISPR ATGGTGCTTTGTGACGTATA AGG Intronic