ID: 1186324604

View in Genome Browser
Species Human (GRCh38)
Location X:8465284-8465306
Sequence AAGGCCTTCCTTCCCGCCCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 3, 1: 3, 2: 2, 3: 15, 4: 142}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186324600_1186324604 6 Left 1186324600 X:8465255-8465277 CCATGTCCTGATGGTGCTTTGTG 0: 3
1: 3
2: 0
3: 23
4: 256
Right 1186324604 X:8465284-8465306 AAGGCCTTCCTTCCCGCCCAGGG 0: 3
1: 3
2: 2
3: 15
4: 142
1186324601_1186324604 0 Left 1186324601 X:8465261-8465283 CCTGATGGTGCTTTGTGACGTAT 0: 3
1: 3
2: 0
3: 4
4: 79
Right 1186324604 X:8465284-8465306 AAGGCCTTCCTTCCCGCCCAGGG 0: 3
1: 3
2: 2
3: 15
4: 142
1186324599_1186324604 9 Left 1186324599 X:8465252-8465274 CCGCCATGTCCTGATGGTGCTTT 0: 5
1: 1
2: 1
3: 14
4: 231
Right 1186324604 X:8465284-8465306 AAGGCCTTCCTTCCCGCCCAGGG 0: 3
1: 3
2: 2
3: 15
4: 142
1186324593_1186324604 25 Left 1186324593 X:8465236-8465258 CCGCCCCCGACTTCATCCGCCAT 0: 6
1: 0
2: 0
3: 10
4: 97
Right 1186324604 X:8465284-8465306 AAGGCCTTCCTTCCCGCCCAGGG 0: 3
1: 3
2: 2
3: 15
4: 142
1186324597_1186324604 19 Left 1186324597 X:8465242-8465264 CCGACTTCATCCGCCATGTCCTG 0: 6
1: 0
2: 0
3: 8
4: 190
Right 1186324604 X:8465284-8465306 AAGGCCTTCCTTCCCGCCCAGGG 0: 3
1: 3
2: 2
3: 15
4: 142
1186324589_1186324604 29 Left 1186324589 X:8465232-8465254 CCCCCCGCCCCCGACTTCATCCG 0: 6
1: 0
2: 0
3: 17
4: 189
Right 1186324604 X:8465284-8465306 AAGGCCTTCCTTCCCGCCCAGGG 0: 3
1: 3
2: 2
3: 15
4: 142
1186324596_1186324604 20 Left 1186324596 X:8465241-8465263 CCCGACTTCATCCGCCATGTCCT 0: 6
1: 0
2: 0
3: 7
4: 114
Right 1186324604 X:8465284-8465306 AAGGCCTTCCTTCCCGCCCAGGG 0: 3
1: 3
2: 2
3: 15
4: 142
1186324595_1186324604 21 Left 1186324595 X:8465240-8465262 CCCCGACTTCATCCGCCATGTCC 0: 6
1: 0
2: 0
3: 5
4: 72
Right 1186324604 X:8465284-8465306 AAGGCCTTCCTTCCCGCCCAGGG 0: 3
1: 3
2: 2
3: 15
4: 142
1186324591_1186324604 27 Left 1186324591 X:8465234-8465256 CCCCGCCCCCGACTTCATCCGCC 0: 6
1: 0
2: 1
3: 8
4: 151
Right 1186324604 X:8465284-8465306 AAGGCCTTCCTTCCCGCCCAGGG 0: 3
1: 3
2: 2
3: 15
4: 142
1186324592_1186324604 26 Left 1186324592 X:8465235-8465257 CCCGCCCCCGACTTCATCCGCCA 0: 6
1: 0
2: 0
3: 11
4: 137
Right 1186324604 X:8465284-8465306 AAGGCCTTCCTTCCCGCCCAGGG 0: 3
1: 3
2: 2
3: 15
4: 142
1186324594_1186324604 22 Left 1186324594 X:8465239-8465261 CCCCCGACTTCATCCGCCATGTC 0: 6
1: 0
2: 0
3: 1
4: 61
Right 1186324604 X:8465284-8465306 AAGGCCTTCCTTCCCGCCCAGGG 0: 3
1: 3
2: 2
3: 15
4: 142
1186324590_1186324604 28 Left 1186324590 X:8465233-8465255 CCCCCGCCCCCGACTTCATCCGC 0: 6
1: 0
2: 1
3: 11
4: 212
Right 1186324604 X:8465284-8465306 AAGGCCTTCCTTCCCGCCCAGGG 0: 3
1: 3
2: 2
3: 15
4: 142
1186324588_1186324604 30 Left 1186324588 X:8465231-8465253 CCCCCCCGCCCCCGACTTCATCC 0: 6
1: 1
2: 6
3: 39
4: 549
Right 1186324604 X:8465284-8465306 AAGGCCTTCCTTCCCGCCCAGGG 0: 3
1: 3
2: 2
3: 15
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186324604 Original CRISPR AAGGCCTTCCTTCCCGCCCA GGG Exonic