ID: 1186324607

View in Genome Browser
Species Human (GRCh38)
Location X:8465294-8465316
Sequence TTCCCGCCCAGGGCTACCAT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 2, 1: 4, 2: 1, 3: 5, 4: 68}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186324596_1186324607 30 Left 1186324596 X:8465241-8465263 CCCGACTTCATCCGCCATGTCCT 0: 6
1: 0
2: 0
3: 7
4: 114
Right 1186324607 X:8465294-8465316 TTCCCGCCCAGGGCTACCATTGG 0: 2
1: 4
2: 1
3: 5
4: 68
1186324601_1186324607 10 Left 1186324601 X:8465261-8465283 CCTGATGGTGCTTTGTGACGTAT 0: 3
1: 3
2: 0
3: 4
4: 79
Right 1186324607 X:8465294-8465316 TTCCCGCCCAGGGCTACCATTGG 0: 2
1: 4
2: 1
3: 5
4: 68
1186324597_1186324607 29 Left 1186324597 X:8465242-8465264 CCGACTTCATCCGCCATGTCCTG 0: 6
1: 0
2: 0
3: 8
4: 190
Right 1186324607 X:8465294-8465316 TTCCCGCCCAGGGCTACCATTGG 0: 2
1: 4
2: 1
3: 5
4: 68
1186324599_1186324607 19 Left 1186324599 X:8465252-8465274 CCGCCATGTCCTGATGGTGCTTT 0: 5
1: 1
2: 1
3: 14
4: 231
Right 1186324607 X:8465294-8465316 TTCCCGCCCAGGGCTACCATTGG 0: 2
1: 4
2: 1
3: 5
4: 68
1186324600_1186324607 16 Left 1186324600 X:8465255-8465277 CCATGTCCTGATGGTGCTTTGTG 0: 3
1: 3
2: 0
3: 23
4: 256
Right 1186324607 X:8465294-8465316 TTCCCGCCCAGGGCTACCATTGG 0: 2
1: 4
2: 1
3: 5
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186324607 Original CRISPR TTCCCGCCCAGGGCTACCAT TGG Exonic