ID: 1186324614

View in Genome Browser
Species Human (GRCh38)
Location X:8465305-8465327
Sequence GGCTACCATTGGCTGGGTAG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 5, 1: 1, 2: 3, 3: 21, 4: 338}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186324600_1186324614 27 Left 1186324600 X:8465255-8465277 CCATGTCCTGATGGTGCTTTGTG 0: 3
1: 3
2: 0
3: 23
4: 256
Right 1186324614 X:8465305-8465327 GGCTACCATTGGCTGGGTAGTGG 0: 5
1: 1
2: 3
3: 21
4: 338
1186324601_1186324614 21 Left 1186324601 X:8465261-8465283 CCTGATGGTGCTTTGTGACGTAT 0: 3
1: 3
2: 0
3: 4
4: 79
Right 1186324614 X:8465305-8465327 GGCTACCATTGGCTGGGTAGTGG 0: 5
1: 1
2: 3
3: 21
4: 338
1186324599_1186324614 30 Left 1186324599 X:8465252-8465274 CCGCCATGTCCTGATGGTGCTTT 0: 5
1: 1
2: 1
3: 14
4: 231
Right 1186324614 X:8465305-8465327 GGCTACCATTGGCTGGGTAGTGG 0: 5
1: 1
2: 3
3: 21
4: 338
1186324605_1186324614 -6 Left 1186324605 X:8465288-8465310 CCTTCCTTCCCGCCCAGGGCTAC 0: 2
1: 4
2: 2
3: 31
4: 300
Right 1186324614 X:8465305-8465327 GGCTACCATTGGCTGGGTAGTGG 0: 5
1: 1
2: 3
3: 21
4: 338
1186324606_1186324614 -10 Left 1186324606 X:8465292-8465314 CCTTCCCGCCCAGGGCTACCATT 0: 2
1: 4
2: 2
3: 13
4: 149
Right 1186324614 X:8465305-8465327 GGCTACCATTGGCTGGGTAGTGG 0: 5
1: 1
2: 3
3: 21
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186324614 Original CRISPR GGCTACCATTGGCTGGGTAG TGG Exonic