ID: 1186328517

View in Genome Browser
Species Human (GRCh38)
Location X:8507201-8507223
Sequence CAATGATAAGAAGGGGGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186328517_1186328527 28 Left 1186328517 X:8507201-8507223 CCAACTCCCCCTTCTTATCATTG No data
Right 1186328527 X:8507252-8507274 GAATTTCCTGGGCCATGAACTGG No data
1186328517_1186328523 6 Left 1186328517 X:8507201-8507223 CCAACTCCCCCTTCTTATCATTG No data
Right 1186328523 X:8507230-8507252 CTAGTTTTCCAGGTAAATTTTGG No data
1186328517_1186328525 16 Left 1186328517 X:8507201-8507223 CCAACTCCCCCTTCTTATCATTG No data
Right 1186328525 X:8507240-8507262 AGGTAAATTTTGGAATTTCCTGG No data
1186328517_1186328522 -4 Left 1186328517 X:8507201-8507223 CCAACTCCCCCTTCTTATCATTG No data
Right 1186328522 X:8507220-8507242 ATTGCTTGAACTAGTTTTCCAGG No data
1186328517_1186328528 29 Left 1186328517 X:8507201-8507223 CCAACTCCCCCTTCTTATCATTG No data
Right 1186328528 X:8507253-8507275 AATTTCCTGGGCCATGAACTGGG No data
1186328517_1186328526 17 Left 1186328517 X:8507201-8507223 CCAACTCCCCCTTCTTATCATTG No data
Right 1186328526 X:8507241-8507263 GGTAAATTTTGGAATTTCCTGGG No data
1186328517_1186328529 30 Left 1186328517 X:8507201-8507223 CCAACTCCCCCTTCTTATCATTG No data
Right 1186328529 X:8507254-8507276 ATTTCCTGGGCCATGAACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186328517 Original CRISPR CAATGATAAGAAGGGGGAGT TGG (reversed) Intergenic
No off target data available for this crispr