ID: 1186328519

View in Genome Browser
Species Human (GRCh38)
Location X:8507208-8507230
Sequence GTTCAAGCAATGATAAGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186328519_1186328528 22 Left 1186328519 X:8507208-8507230 CCCCTTCTTATCATTGCTTGAAC No data
Right 1186328528 X:8507253-8507275 AATTTCCTGGGCCATGAACTGGG No data
1186328519_1186328523 -1 Left 1186328519 X:8507208-8507230 CCCCTTCTTATCATTGCTTGAAC No data
Right 1186328523 X:8507230-8507252 CTAGTTTTCCAGGTAAATTTTGG No data
1186328519_1186328526 10 Left 1186328519 X:8507208-8507230 CCCCTTCTTATCATTGCTTGAAC No data
Right 1186328526 X:8507241-8507263 GGTAAATTTTGGAATTTCCTGGG No data
1186328519_1186328527 21 Left 1186328519 X:8507208-8507230 CCCCTTCTTATCATTGCTTGAAC No data
Right 1186328527 X:8507252-8507274 GAATTTCCTGGGCCATGAACTGG No data
1186328519_1186328525 9 Left 1186328519 X:8507208-8507230 CCCCTTCTTATCATTGCTTGAAC No data
Right 1186328525 X:8507240-8507262 AGGTAAATTTTGGAATTTCCTGG No data
1186328519_1186328529 23 Left 1186328519 X:8507208-8507230 CCCCTTCTTATCATTGCTTGAAC No data
Right 1186328529 X:8507254-8507276 ATTTCCTGGGCCATGAACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186328519 Original CRISPR GTTCAAGCAATGATAAGAAG GGG (reversed) Intergenic
No off target data available for this crispr