ID: 1186328525

View in Genome Browser
Species Human (GRCh38)
Location X:8507240-8507262
Sequence AGGTAAATTTTGGAATTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186328520_1186328525 8 Left 1186328520 X:8507209-8507231 CCCTTCTTATCATTGCTTGAACT No data
Right 1186328525 X:8507240-8507262 AGGTAAATTTTGGAATTTCCTGG No data
1186328519_1186328525 9 Left 1186328519 X:8507208-8507230 CCCCTTCTTATCATTGCTTGAAC No data
Right 1186328525 X:8507240-8507262 AGGTAAATTTTGGAATTTCCTGG No data
1186328521_1186328525 7 Left 1186328521 X:8507210-8507232 CCTTCTTATCATTGCTTGAACTA No data
Right 1186328525 X:8507240-8507262 AGGTAAATTTTGGAATTTCCTGG No data
1186328517_1186328525 16 Left 1186328517 X:8507201-8507223 CCAACTCCCCCTTCTTATCATTG No data
Right 1186328525 X:8507240-8507262 AGGTAAATTTTGGAATTTCCTGG No data
1186328518_1186328525 10 Left 1186328518 X:8507207-8507229 CCCCCTTCTTATCATTGCTTGAA No data
Right 1186328525 X:8507240-8507262 AGGTAAATTTTGGAATTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186328525 Original CRISPR AGGTAAATTTTGGAATTTCC TGG Intergenic
No off target data available for this crispr