ID: 1186329979

View in Genome Browser
Species Human (GRCh38)
Location X:8521919-8521941
Sequence TACATAGCTTGTTAAATCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186329979_1186329984 20 Left 1186329979 X:8521919-8521941 CCATAGATTTAACAAGCTATGTA No data
Right 1186329984 X:8521962-8521984 TTATTGGAGGACAGTCTGACAGG No data
1186329979_1186329981 7 Left 1186329979 X:8521919-8521941 CCATAGATTTAACAAGCTATGTA No data
Right 1186329981 X:8521949-8521971 TTGCAACTTGCCCTTATTGGAGG No data
1186329979_1186329980 4 Left 1186329979 X:8521919-8521941 CCATAGATTTAACAAGCTATGTA No data
Right 1186329980 X:8521946-8521968 CTTTTGCAACTTGCCCTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186329979 Original CRISPR TACATAGCTTGTTAAATCTA TGG (reversed) Intergenic
No off target data available for this crispr