ID: 1186336513

View in Genome Browser
Species Human (GRCh38)
Location X:8595483-8595505
Sequence AAGTGGGAGCTAAAGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 679
Summary {0: 1, 1: 0, 2: 14, 3: 51, 4: 613}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186336506_1186336513 15 Left 1186336506 X:8595445-8595467 CCGGTTGAATTACATAGATTTCA 0: 1
1: 0
2: 0
3: 11
4: 174
Right 1186336513 X:8595483-8595505 AAGTGGGAGCTAAAGGAAGATGG 0: 1
1: 0
2: 14
3: 51
4: 613

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186336513 Original CRISPR AAGTGGGAGCTAAAGGAAGA TGG Intronic
900159428 1:1216474-1216496 CAGTGGGAGCTCAGGGAAGCCGG - Intergenic
900723717 1:4200124-4200146 AAGTGGGAGCTAAGCTATGAGGG + Intergenic
901807469 1:11747641-11747663 AAGTGGTGGCCCAAGGAAGAGGG - Intronic
902111531 1:14082836-14082858 AAGTGGGAGGTAAAGTGGGAGGG - Intergenic
902459451 1:16561991-16562013 AAGTGGCAGGTAAAGGAGGTAGG + Intergenic
902522757 1:17030277-17030299 CAGTGGGAGGCAAAGGCAGAAGG - Intronic
902793929 1:18787991-18788013 AAGGGGGAGGGAAAGAAAGAGGG + Intergenic
903152647 1:21422671-21422693 AAGTGGCAGGTAAAGGAGGTAGG + Intergenic
903160482 1:21485314-21485336 AAGTGGCAGGTAAAGGAGGTAGG - Intergenic
903758795 1:25683619-25683641 AGCTGGGACCTGAAGGAAGATGG + Intronic
904905214 1:33892529-33892551 AAGTGGGAGCTAAGCTATGAGGG - Intronic
905754379 1:40496453-40496475 AATTGGGAGGTCAAGGAAGGAGG + Intergenic
906070770 1:43014876-43014898 AAGTGGGAGCTAAGCTATGAGGG + Intergenic
907186226 1:52611322-52611344 AAGTGGGAGGGAAAGAGAGAGGG + Intergenic
907378716 1:54066995-54067017 AGGTTGAAGTTAAAGGAAGAGGG + Intronic
908263634 1:62358184-62358206 AAGGGGGAGGTAAAGAAGGAAGG - Intergenic
908936299 1:69381183-69381205 AAGTGGGATGGAAAGGGAGATGG - Intergenic
909276353 1:73691317-73691339 AAGTGAGAGCTAACTGTAGAGGG - Intergenic
909760139 1:79276229-79276251 AAGTGGGAGCGAAATGATGATGG + Intergenic
910233637 1:85012030-85012052 AAGTGGGAGCTAAGCTATGAGGG + Intronic
911110470 1:94178742-94178764 TAGTGGGTACTGAAGGAAGATGG + Intronic
911622604 1:100082339-100082361 CCGTGGGAACTAAAGGAAGTGGG + Exonic
911875761 1:103160906-103160928 AATTGGAAGCCAAAGGAAAAGGG + Intergenic
912509522 1:110179505-110179527 AAGGGGAAGGGAAAGGAAGAAGG - Intronic
912702443 1:111888276-111888298 AAATGGGAGGGAAAGGAAGATGG + Intronic
912775692 1:112505087-112505109 AAGTGGGTGCCCAAAGAAGAAGG - Intronic
913053581 1:115137913-115137935 AAGAGGGAGCTGCAAGAAGAAGG - Intergenic
913154421 1:116080930-116080952 AAGAGAGAGCGAAAGAAAGAAGG - Intergenic
913606132 1:120468163-120468185 AAGTGGCAGGTAAAGGAGGTAGG - Intergenic
913644318 1:120842538-120842560 AAGTGGCAGGTAAAGGAGGTAGG - Intergenic
914177323 1:145289551-145289573 AAGTGGCAGGTAAAGGAGGTAGG + Intergenic
914210299 1:145571989-145572011 AAGTGGCAGGTAAAGGAGGTAGG + Intergenic
914269218 1:146064351-146064373 AAGTGGCAGGTAAAGGAGGTAGG + Intergenic
914310201 1:146459435-146459457 GAGTGGGAGCTGAAAGGAGAAGG - Intergenic
914367876 1:146996505-146996527 AAGTGGCAGGTAAAGGAGGTAGG - Intergenic
914485103 1:148101703-148101725 AAGTGGCAGGTAAAGGAGGTAGG + Intergenic
914532051 1:148531042-148531064 AAGTGGCAGGTAAAGGAGGTAGG + Intergenic
914585065 1:149053678-149053700 AAGTGGCAGGTAAAGGAGGTAGG + Intergenic
914636343 1:149556688-149556710 AAGTGGCAGGTAAAGGAGGTAGG - Intergenic
914799648 1:150951184-150951206 AGGGAGGAGGTAAAGGAAGATGG - Intronic
915335946 1:155141387-155141409 AACTTGGAGCCAGAGGAAGAAGG + Intergenic
915575979 1:156777470-156777492 ATGTGGGGGATAAAGGAAAAGGG - Intronic
915811861 1:158921296-158921318 AAATGAGAGCTGAGGGAAGAAGG - Intergenic
916223152 1:162464578-162464600 AAGGGGAACCTAAAGGAGGAGGG - Intergenic
916567326 1:165992431-165992453 ATTTGGGAGTTAAAGAAAGAGGG + Intergenic
916677045 1:167072868-167072890 AAGTGGGGGATAGAGGATGAGGG + Intronic
917731136 1:177876144-177876166 AAGCTGGAGCTTATGGAAGAAGG - Intergenic
918950624 1:191132005-191132027 AAGTGGGAGCTAAATATTGAGGG + Intergenic
919355205 1:196513630-196513652 AAGTGAGAGCTGAAGGAAGAAGG - Intronic
920116351 1:203624464-203624486 AAGAGGGAGGGAAGGGAAGAGGG + Intergenic
920116356 1:203624480-203624502 AAGAGGGAGGGAATGGAAGAGGG + Intergenic
920601872 1:207333924-207333946 AAGTGAGACAAAAAGGAAGAGGG + Intronic
920810802 1:209283767-209283789 AAGTGGGAGCTGGAGCAGGAAGG - Intergenic
920953799 1:210598896-210598918 AAGTGGGAGGTGAAGCAATATGG - Intronic
921309130 1:213825382-213825404 AAGTGGAATATAAAGGAAGAGGG + Intergenic
921747644 1:218755369-218755391 AAGTGAGAGCAATAGGCAGATGG - Intergenic
922229759 1:223675473-223675495 TAGTGGGAGCAAGAGGAAGGAGG + Intergenic
922656498 1:227389031-227389053 ATTTGGGTGCTAAAGGAAGAAGG + Intergenic
922930336 1:229384003-229384025 AAGTGGGGGTTCAATGAAGATGG - Intergenic
922936910 1:229430322-229430344 AAGTGAGAGCTCCAGAAAGAAGG - Intergenic
922944175 1:229496532-229496554 AGGTTGGATCTATAGGAAGAAGG + Intronic
922975064 1:229777631-229777653 AAGGGGAAGCAACAGGAAGAGGG + Intergenic
923264280 1:232298821-232298843 AAGTGGGAGGTAAAGGAACAAGG - Intergenic
924157944 1:241200668-241200690 GAGAGGGAGCTTTAGGAAGACGG - Intronic
924272093 1:242344493-242344515 ACGTGGGAGGAAAAGGAAGTAGG + Intronic
1062836340 10:638663-638685 AAATGGGAGGTAAGGGGAGAGGG - Intronic
1063470845 10:6283594-6283616 AAGTGAGAAATAAAGCAAGATGG + Intergenic
1064528587 10:16283907-16283929 AGGTGAGAGATAAGGGAAGAGGG + Intergenic
1065171456 10:23034656-23034678 GAGTGGGAGCGAAAGCCAGATGG - Intronic
1066107203 10:32166514-32166536 ATATGAGAGCTAAAGAAAGAGGG + Intergenic
1066236166 10:33486812-33486834 AAGTGGGAGCTAAGACAGGAAGG + Intergenic
1066466802 10:35658926-35658948 AAGAGGGGCCTAAAGGCAGAGGG - Intergenic
1066712574 10:38251645-38251667 ACGTGGGAGGAAAAGGAAGTAGG - Intergenic
1067082006 10:43217289-43217311 AAATGGGAGCCAAAGGGGGATGG - Intronic
1067208195 10:44237495-44237517 AAGTGGGAAGAAAAGGAAGAAGG + Intergenic
1067233659 10:44428561-44428583 AAGTGGGAGCTAAGCTATGAGGG - Intergenic
1067259821 10:44679671-44679693 AAGTGGGAGCGAAAAAATGAGGG - Intergenic
1067392116 10:45873461-45873483 AAGTGGGAGTTAAAAGACAATGG + Intergenic
1067402816 10:45992939-45992961 AAGTGGGAGTTAAAAGACAATGG - Intronic
1067871167 10:49962584-49962606 AAGTGGGAGTTAAAAGACAATGG - Intronic
1067995606 10:51269647-51269669 AAGTGGAAGCTAAACTATGAGGG + Intronic
1069107399 10:64399793-64399815 AAGTGGGAGCTAAACTATGAGGG - Intergenic
1069646352 10:70001342-70001364 GAGTGGGAGCTGAGGGAAGGGGG - Intergenic
1069826356 10:71257316-71257338 AAGTGGGAGGTAAGTGAATAGGG + Intronic
1070020139 10:72577116-72577138 AAGTGGGAGCTAAGCTATGAGGG + Intronic
1071379327 10:85042375-85042397 AGGTGGGAGCTAAAGGAGGAGGG + Intergenic
1071433391 10:85624046-85624068 TACTGGGAGATACAGGAAGAAGG - Intronic
1072160055 10:92757564-92757586 AAGCAGGTGTTAAAGGAAGAGGG + Intergenic
1072794808 10:98346586-98346608 AAGGGGGAGGAAAGGGAAGAGGG + Intergenic
1072811707 10:98467500-98467522 AAGGGGGAGAGAAAGGAGGAGGG + Intronic
1073626044 10:105098220-105098242 AAGTGGGGGCTAAAGGCAATGGG + Intronic
1073740927 10:106406069-106406091 AAGTGGTAAATAAAGTAAGAGGG + Intergenic
1073956019 10:108872305-108872327 AAGTGAGAGGTAAGGGAAGGAGG + Intergenic
1074661526 10:115663982-115664004 AAGTGGGAGCTGTGGGAAAATGG - Intronic
1074816968 10:117149632-117149654 AAATGGAAGCTACAGGAAAAGGG + Intergenic
1075494275 10:122906291-122906313 AAGTGGGAGCTAAGCCATGAGGG + Intergenic
1077222635 11:1424349-1424371 GTGTGGGGGCAAAAGGAAGAAGG + Intronic
1078000109 11:7487033-7487055 AAGTCGGTGCTAAATGCAGAGGG - Intronic
1078612873 11:12837197-12837219 AAGTGGGCAAGAAAGGAAGAGGG - Intronic
1078866423 11:15302279-15302301 AAGTGGGAACTTAAGGAAAGAGG + Intergenic
1079180839 11:18192183-18192205 AAGTGGGAGCTAAGCTATGAGGG + Intronic
1079482520 11:20896192-20896214 AAGTGGGAGCTAAGCTATGAGGG - Intronic
1080849876 11:36058992-36059014 CAGAGGGAGGTAAAGGAAGCAGG - Intronic
1082043399 11:47705710-47705732 AAGGGGGAACTAAAGGCTGAGGG + Intronic
1082073538 11:47958755-47958777 AAGTGGGACCAAGAGGAGGATGG - Intergenic
1082765206 11:57162264-57162286 AAGGAGGAGCTAAAGGAATGAGG + Intergenic
1082774201 11:57233475-57233497 AAGTGGGAGCTAAAAGGAGGGGG - Intergenic
1083511885 11:63216657-63216679 AAGTGGGAGCTAAAGGTGGGAGG + Intronic
1083759553 11:64808106-64808128 AAGGGGGAGGTAATGAAAGAGGG + Intronic
1084687655 11:70706413-70706435 AAGTTGGAGATACAGGAAGCTGG + Intronic
1085738634 11:79060984-79061006 CAGTGGGAACTAGAGAAAGATGG + Intronic
1087685738 11:101262534-101262556 AACTAGGATCTAAAGAAAGAAGG - Intergenic
1088213078 11:107477652-107477674 AAATGGAAGCTAAGGGTAGATGG + Intergenic
1088335046 11:108694512-108694534 AAGTGGGGAGTATAGGAAGAAGG - Intronic
1088499255 11:110466666-110466688 AAATGGGAGTCAAAGGAAAAAGG - Intergenic
1089406830 11:118204437-118204459 AAGTCAGAGGTAAAGGGAGATGG - Intronic
1089489773 11:118875234-118875256 AAGAGGGAACGAAAGGAAGGAGG + Intergenic
1089728157 11:120501221-120501243 GTTTGGGAGCTGAAGGAAGAGGG - Intergenic
1089910991 11:122100716-122100738 AAGTGCACGCTAAAGAAAGAAGG - Intergenic
1090146836 11:124333822-124333844 AAGTGGGAGGTAAATGAGCAAGG - Intergenic
1090508788 11:127349216-127349238 AAGAGGAAACTAAAGAAAGAAGG + Intergenic
1090900535 11:131026959-131026981 AAGTGGGAACTGAAGAAAGCTGG + Intergenic
1091002242 11:131919421-131919443 ATGTGTGAGCTGAAGGGAGAAGG + Intronic
1091069294 11:132548260-132548282 AAGTAGGCTCTAAAGGAAGTAGG + Intronic
1091218382 11:133917321-133917343 AGGTGGAAGCTAAAGGAACTTGG - Intronic
1092158229 12:6298954-6298976 AAGTGGGAGCTAAGCTATGAGGG + Intergenic
1092223011 12:6728142-6728164 AAGTGGGAGGGAAGGGAAGGAGG + Intronic
1092456700 12:8650261-8650283 AGGTGGGCGCTGGAGGAAGAAGG - Intronic
1093360610 12:18222024-18222046 AAATGGGAGCTAAAGACAGGGGG + Intronic
1093849458 12:24018105-24018127 TAGGGGCAGATAAAGGAAGATGG - Intergenic
1094454265 12:30614625-30614647 AAGTGGGAGTTGAATGATGAGGG - Intergenic
1094586738 12:31783909-31783931 TATAGAGAGCTAAAGGAAGAAGG + Intergenic
1094590312 12:31813499-31813521 TAGAGGGAGCCAAAGGGAGAGGG - Intergenic
1096949957 12:55457962-55457984 AAGTGGAAGCCAAAGGATAATGG + Intergenic
1097311566 12:58124542-58124564 AAGTGGGAGCTGAACAATGAGGG - Intergenic
1097312959 12:58141185-58141207 AAGTGGGAGCAAGAGAAAGAGGG - Intergenic
1097840677 12:64318483-64318505 AAATGGGAGGTAAAGGAGGGAGG + Intronic
1098392550 12:69984882-69984904 AAGAGGGAGCTCTAGGAAGTGGG + Intergenic
1098464952 12:70776051-70776073 AAGTGGGACATTCAGGAAGAGGG - Intronic
1098608104 12:72419511-72419533 GAGTGGGAGCAAGAGGGAGATGG + Intronic
1099247881 12:80215722-80215744 ATTTTGGAGCCAAAGGAAGAAGG + Intronic
1099810990 12:87582065-87582087 GAGTTGGAGCTAATGGCAGAGGG + Intergenic
1100059652 12:90558682-90558704 AAGTGTGAGCTAAACAATGAAGG - Intergenic
1100877271 12:98975308-98975330 AAGAAGGAGGAAAAGGAAGAAGG - Intronic
1100949033 12:99824582-99824604 GAGGGGGAGATAAAGGAAGAGGG + Intronic
1102381143 12:112467884-112467906 AGGTGGGGCCTAAAGGAAGGTGG - Intronic
1102598805 12:114013085-114013107 AAGAGGGAGATAAAGGGAGTGGG + Intergenic
1103854063 12:123952777-123952799 AAGTGGAAGCAAAAAGTAGAAGG + Intronic
1104061552 12:125272683-125272705 ATGGGGGAGCTAAAGGCGGAGGG + Intronic
1104155796 12:126130437-126130459 ATGTGGGAGCTACACCAAGATGG - Intergenic
1104703002 12:130921440-130921462 AAGTGGGAGCAGAAGGAAGGGGG + Intergenic
1106222558 13:27758675-27758697 AAGGGGGAGCTAAACGAAGAAGG - Intergenic
1107115051 13:36738034-36738056 AGGTTGGGGCTTAAGGAAGAGGG + Intergenic
1107276157 13:38681642-38681664 GAGTTGGTGCAAAAGGAAGAAGG + Intergenic
1107285232 13:38782923-38782945 TAGTGGGAGGAAAAGGAGGAAGG - Intronic
1107314149 13:39113002-39113024 AGGTGGTAGATAAAGGGAGAAGG + Intergenic
1107758485 13:43651240-43651262 AAGAGGAAGAAAAAGGAAGAGGG + Intronic
1108113333 13:47101411-47101433 AAACGGGAGGTAGAGGAAGAGGG - Intergenic
1108516156 13:51204750-51204772 GAGAGGGAGCTAAAGAGAGATGG - Intergenic
1109288063 13:60435478-60435500 AAGTGGGAGCTAAGGCATGAGGG - Intronic
1109786527 13:67182793-67182815 GAGTGGCATGTAAAGGAAGAGGG - Intronic
1110668149 13:78142274-78142296 GTGTGGGAGTTGAAGGAAGAAGG + Intergenic
1110680730 13:78309069-78309091 AAGTGGGAGGTGAGGGAAGGAGG + Intergenic
1110833160 13:80054530-80054552 AGGCAGGAGCTCAAGGAAGAGGG + Intergenic
1111068792 13:83134953-83134975 GAGTGGGAGTGAAAGGAGGAGGG - Intergenic
1111231422 13:85348676-85348698 AAGTGAGAGCAAAAGAAGGAAGG - Intergenic
1111872420 13:93849492-93849514 AGGTGAGAGCTAGAGGGAGATGG - Intronic
1111995497 13:95162209-95162231 ATGTGGAAACTAAAGGAAGAAGG - Intronic
1112318715 13:98388290-98388312 TTATGGGAGCTAAAGGAAGAGGG - Intronic
1112840275 13:103567403-103567425 AAATGATAGCTAAAGGAAAATGG + Intergenic
1113567526 13:111327660-111327682 CCGTGGGAGGTAAAGGAAGCAGG - Intronic
1114081235 14:19202673-19202695 AAGTGGGAGCAAAAGAGAGTGGG - Intergenic
1114398060 14:22384499-22384521 CAGTGGTAGGTAGAGGAAGAAGG + Intergenic
1114867699 14:26617699-26617721 AAGTGGGAGCTAAACATTGAAGG + Intergenic
1114944672 14:27664794-27664816 AAGTGGGAGGTAAATGATAAAGG - Intergenic
1115023144 14:28707571-28707593 CAGTGGGACCAAAAGCAAGAAGG + Intergenic
1115212949 14:30986133-30986155 AAATGGAAGGTAAATGAAGAGGG - Intronic
1115495753 14:34002932-34002954 AAGAGGGAGCTTTAGGATGATGG + Intronic
1115568923 14:34648988-34649010 AAGTGGGAGAGATAGGAGGAGGG + Intergenic
1116437912 14:44914462-44914484 AAAAGAGAGCTGAAGGAAGAGGG - Intergenic
1116928904 14:50670305-50670327 AGGCGGGAGCTGAAGGAGGAAGG + Intergenic
1117861268 14:60094775-60094797 AGGTGGGAGTTAAAGAAAGATGG - Intronic
1118236852 14:64013538-64013560 AAGTGGGAGCTAAACAATGGGGG - Intronic
1119041018 14:71274635-71274657 AAATTGAAGCTAAAGGAGGAGGG - Intergenic
1119239553 14:73047660-73047682 AAGTGGAAACTCAAGGTAGAAGG - Intergenic
1120067466 14:80060302-80060324 AAGTGGGAGCTAAAGCTATGAGG + Intergenic
1120189762 14:81429967-81429989 AAGTGGGAGAGAAGGGAAGTCGG - Intronic
1120717412 14:87854775-87854797 AAGAGAGAGCTAAAGGAATTTGG + Intronic
1120735847 14:88051624-88051646 AAGTGGGAGCTAAACTATGAGGG - Intergenic
1121049819 14:90812976-90812998 AAGTGGGAGCTTTGGGAAGGAGG + Intronic
1121377747 14:93430225-93430247 AAGTTGGGGCTGAAGGAAGGAGG - Intronic
1121529995 14:94645558-94645580 AAGTCTGAGCCAAAGTAAGAAGG - Intergenic
1122141332 14:99664609-99664631 AAGTGGGAGCTGAGGGCAGGGGG - Intronic
1122304668 14:100755093-100755115 AGGTTTGAGCTAGAGGAAGAAGG + Intergenic
1123072730 14:105649549-105649571 AAGTGGGAGGTAAGGGGGGATGG + Intergenic
1124389139 15:29238207-29238229 GAGTGAGAGCTAAAGGTACAGGG + Intronic
1124440049 15:29679012-29679034 AAGTGTGAGCTACATGTAGAGGG - Intergenic
1124707977 15:31981306-31981328 GAGAGGGAGGGAAAGGAAGAGGG + Intergenic
1126305046 15:47246344-47246366 CAGTGGGAGCTAAAGCATGAGGG + Intronic
1126436204 15:48640824-48640846 ACTTGGGAGCTAAAGCAATAAGG + Intronic
1126562994 15:50064840-50064862 AAGCAGGAGCAAAAGGGAGAGGG + Intronic
1126988213 15:54339475-54339497 AAGTGGGAGCTAAGCTATGAGGG - Intronic
1128334318 15:66776331-66776353 AAGTGGGTGCAGAAGGAAGGAGG - Intronic
1128580773 15:68808115-68808137 AAGTGGAAACTAGAGGAAAATGG - Intronic
1128648325 15:69393079-69393101 AAGTGGGAGCTGAGGGGAGAGGG + Intronic
1128865874 15:71115173-71115195 AAGTGAGAGGAAAAGGGAGAGGG - Exonic
1128946353 15:71824813-71824835 GAGTGGCAGCTAAAGGTAGCAGG - Exonic
1128984011 15:72206285-72206307 AATTGGAAGCCAAAGGAAGAGGG + Intronic
1130130404 15:81136359-81136381 AAGGGGAAGGGAAAGGAAGAAGG + Intronic
1130338673 15:82980030-82980052 AAGTGGCAGGCAGAGGAAGAGGG + Intronic
1130513524 15:84608167-84608189 AAGGGAGAGGGAAAGGAAGAGGG - Intronic
1131330191 15:91490934-91490956 GAGTGTGGGCTAGAGGAAGAGGG + Intergenic
1131662877 15:94537632-94537654 GAGAGGGAGAGAAAGGAAGAGGG + Intergenic
1131705024 15:94984464-94984486 AAGTGGGAGCTAAATGACGCAGG + Intergenic
1131793335 15:95988396-95988418 AAGAGGGAGGGGAAGGAAGAGGG + Intergenic
1132210650 15:100019845-100019867 AAGTGTGAGCTGGAGGGAGATGG - Intronic
1132436421 15:101808062-101808084 AAGGGGGAGATAAAGGAAAGAGG + Intronic
1133335598 16:5004767-5004789 AAGTGGGAGAGAGAGAAAGAAGG - Intronic
1134507276 16:14818490-14818512 CAGTGGGAGTTTAGGGAAGATGG - Intronic
1134694977 16:16217248-16217270 CAGTGGGAGTTTAGGGAAGATGG - Intronic
1134976854 16:18577404-18577426 CAGTGGGAGTTTAGGGAAGATGG + Intergenic
1135223182 16:20631798-20631820 AAGTGGGAGCTAAGCTATGAAGG + Intronic
1135294821 16:21270057-21270079 AAGTGGGAAAAGAAGGAAGAAGG + Intronic
1135554022 16:23420463-23420485 GGCTGGGAGCTAGAGGAAGAGGG - Intronic
1135667844 16:24351012-24351034 ACTTGGGAGCTAAAGGAACCAGG + Intronic
1135868127 16:26123724-26123746 AAGTGGGAGCTAAGCTATGAAGG - Intronic
1135968244 16:27053102-27053124 AGGTGGGTGCTAGAGGCAGAGGG - Intergenic
1136075339 16:27813281-27813303 AAGTGAGAGCTAAATGATGAGGG - Intronic
1136538269 16:30913290-30913312 AACTGTGAGCTGAAGGAAGGAGG + Intergenic
1137685484 16:50383756-50383778 AAGTGGGAGGCAAACAAAGATGG + Intergenic
1139239755 16:65378692-65378714 AAGTGGGAGCTAAGCCATGAGGG - Intergenic
1140799915 16:78476928-78476950 AAGAGGGAACTGAAGGAGGAAGG - Intronic
1140858645 16:79000252-79000274 AGATGGGATCTAAAGGAAGGAGG - Intronic
1141906130 16:87028248-87028270 AAGTCAGAGCTCAAGGAAGATGG + Intergenic
1141923473 16:87152133-87152155 GAGTGGGAGCAAGAGGGAGAAGG - Intronic
1143250237 17:5518136-5518158 ATGGGGGAGGTGAAGGAAGAAGG - Intronic
1143689072 17:8545415-8545437 AAGGACGAGCTAGAGGAAGAGGG + Intronic
1143965770 17:10755709-10755731 GAGAGGGAGGAAAAGGAAGAGGG - Intergenic
1144169704 17:12648082-12648104 AAGTGGTATGTAAAAGAAGAAGG - Intergenic
1144239220 17:13293646-13293668 AAGAGGGAGAGAAAGAAAGAGGG - Intergenic
1144843903 17:18205954-18205976 AGGTGGGAGCAAAGGGCAGAAGG - Intronic
1145913955 17:28559770-28559792 TAGAGGGAGCTATAGGAAGGTGG + Intronic
1146025317 17:29315443-29315465 GAGTGGGAGGTAAAGAATGAGGG + Intergenic
1147948114 17:44091935-44091957 CAGTGGGAGCTCAGGGTAGAGGG - Intronic
1149040658 17:52184585-52184607 AAGTGGGAGAGAAAAGCAGAAGG + Intergenic
1149094443 17:52824382-52824404 AAGTGAGAGCTCAAAGTAGATGG - Intergenic
1150134205 17:62686712-62686734 AAGTGACAGCTAAAGGGGGAGGG - Intronic
1150448714 17:65247811-65247833 AAGTGGCAGAGCAAGGAAGATGG + Intergenic
1150650970 17:67009990-67010012 ATGGGGGAGGTAGAGGAAGAAGG - Intronic
1150732893 17:67711274-67711296 AAGTGGCAGCTAGATGAAGCAGG + Intergenic
1150893760 17:69185082-69185104 AAGTGGGAGCTAAGCTATGAAGG + Intronic
1151353460 17:73545128-73545150 AAGTGGAGGCTCAAGGAAGAAGG + Intronic
1151956576 17:77383144-77383166 AAGAGGGAGGGAAAGAAAGAGGG - Intronic
1152780643 17:82226150-82226172 AACTGGGAACAAAAGGAAGTTGG + Intergenic
1153001934 18:463776-463798 AATTGGGGGCTAGGGGAAGAGGG - Intronic
1153045057 18:848354-848376 AAGTGGGAAGTGAAGGAGGAAGG - Intergenic
1153325313 18:3812588-3812610 AACTGGAAGCCAAAGAAAGAAGG + Intronic
1153567598 18:6434373-6434395 CAGTGGGAGGTCAAGGCAGAAGG - Intergenic
1153759200 18:8313799-8313821 AAATGGGAGCTAAGCTAAGAGGG - Intronic
1153851120 18:9095487-9095509 AAGTGGGCCCCAGAGGAAGAAGG + Intergenic
1154249176 18:12728782-12728804 AAGTGGGAGCTAAGCTATGAGGG + Intergenic
1154381118 18:13850800-13850822 AAGTGGGAGCTAAACAAAGATGG + Intergenic
1154436539 18:14347151-14347173 AAGTGGGAGCTAAGCTATGAGGG - Intergenic
1155095823 18:22555387-22555409 AATTGGGAGCTCAATGAAGCTGG + Intergenic
1155228041 18:23747295-23747317 GAGTGGGAGGTGAAGAAAGAAGG + Intronic
1155669737 18:28355869-28355891 AAATGGGAGCCAAAGGAAAGGGG - Intergenic
1156077621 18:33300132-33300154 GAGTGGGAGCGAAAGAGAGAGGG - Intronic
1156306655 18:35884161-35884183 AGGTGGAAGATAAAGGAATAGGG - Intergenic
1156401333 18:36742872-36742894 AAGGGGGGGCTACAGGATGAGGG - Intronic
1156833018 18:41518228-41518250 AGGTAGGAGCTAAAGGGAGTAGG + Intergenic
1156837242 18:41568788-41568810 AGGTGGGAGATAGAGGAGGAAGG - Intergenic
1157722827 18:49938579-49938601 AAGTGGGGGTTAAAGGAAGAGGG - Intronic
1158813658 18:61068338-61068360 AAGGGGGAGCCCAGGGAAGAAGG - Intergenic
1159034790 18:63266437-63266459 AAGTGGGAGGTAAAGTGAGGAGG + Intronic
1159096258 18:63905864-63905886 AAATAGGAGCTAAATGAATAGGG - Intronic
1159788873 18:72751425-72751447 AACTGGGAGCTGCAGGGAGAGGG - Intronic
1159850731 18:73524338-73524360 AAGTGGGAGCTAAGCTATGAGGG + Intergenic
1159876108 18:73813000-73813022 AGGTGGGAGGCAAAGCAAGATGG - Intergenic
1161637240 19:5396610-5396632 ATCTGGGAGGTAGAGGAAGAAGG + Intergenic
1161845581 19:6710138-6710160 AAGAGGGAGAGAAAGGGAGAGGG + Intronic
1164940467 19:32249143-32249165 ATGAGGGAGATAAAGAAAGAAGG + Intergenic
1165115012 19:33523349-33523371 AAACGAGAGCTAATGGAAGAGGG + Intergenic
1165378997 19:35464550-35464572 AAGAAGGAGCAAAAGGAAAAGGG + Intergenic
1165550617 19:36581691-36581713 AAGAGGGAACAAAAGGGAGAGGG - Intronic
1166844145 19:45716579-45716601 AATTGGGAGATAATGGAGGAGGG - Intronic
1166900141 19:46054835-46054857 AGTTGGAAGATAAAGGAAGATGG + Intronic
1167477988 19:49711992-49712014 AAGTGGGAGACCATGGAAGAAGG + Intronic
1167608628 19:50495195-50495217 AAGTTAGAGATAAGGGAAGAAGG + Intergenic
1168597031 19:57685549-57685571 AAATGGCAGCTAGAGGAAAAGGG - Intronic
1202675696 1_KI270711v1_random:4175-4197 AAGTGGCAGGTAAAGGAGGTAGG + Intergenic
925541304 2:4970611-4970633 AAGTGGGAGAAAAATGAAGAGGG - Intergenic
925796873 2:7555108-7555130 AAGAGAGAGCCAAAGGAAGAGGG - Intergenic
925824404 2:7833298-7833320 ATGTGGGAGCAAAAGGAAAATGG + Intergenic
926226679 2:10971784-10971806 ATGGGGGAGCTCAGGGAAGAGGG + Intergenic
926632056 2:15145655-15145677 GAGTGGGAGCTGCAGTAAGAGGG - Intergenic
926755281 2:16229565-16229587 AATTGAGAGCTAAAGAGAGAAGG - Intergenic
926869244 2:17394316-17394338 AAGTGGGAGCTAAGATATGAGGG + Intergenic
926951547 2:18248810-18248832 AAGGGAGATCTAAAGGAAGCAGG - Intronic
926953075 2:18265168-18265190 AAGTGGGCACCAAAGGAAGCAGG - Intronic
927294256 2:21435535-21435557 AAGTGTGAGCTGAACGAAGGGGG - Intergenic
928160921 2:28923819-28923841 AAGTGGGACCCAAAGGTAGCTGG + Intronic
928889660 2:36189031-36189053 GACTGGGAGCTAAGGGAAGAGGG - Intergenic
929771310 2:44894544-44894566 AAGTTGCAGCTAACAGAAGAAGG - Intergenic
929783882 2:44975492-44975514 AACTGGGAGGTAAAAGCAGAGGG + Intergenic
929872592 2:45771600-45771622 AAGGGGGAGGAAGAGGAAGATGG - Intronic
930049882 2:47206837-47206859 AACTGGGATCAAAAGAAAGAGGG - Intergenic
930535268 2:52637988-52638010 AAGTGGAAGAAGAAGGAAGAAGG - Intergenic
930573854 2:53121918-53121940 AAGTGGGAGCTAAGCTATGAGGG - Intergenic
930579704 2:53195388-53195410 AAGTGTGGGCTACAGGAAGCAGG - Intergenic
930881155 2:56271977-56271999 GATTGGGAGCTAAAGGAGGTGGG + Intronic
931221304 2:60290613-60290635 GAGGGGGAACTAAAGGAAGGTGG + Intergenic
931555603 2:63500195-63500217 CAGTGGGAGATAAAGGTACAAGG + Intronic
931790228 2:65658241-65658263 AAGTGGGAGGAAGAGGCAGAGGG - Intergenic
932022724 2:68104053-68104075 AGGTGGGAGTGGAAGGAAGAAGG + Intronic
932116376 2:69053353-69053375 AAGATGAAGCTAAAGGAAGATGG + Intronic
932317838 2:70797916-70797938 GAGTGGGGGCTACAGGCAGAGGG + Intergenic
932453323 2:71830015-71830037 AAGTGAGAGGGAAAGGAAGGTGG + Intergenic
933630393 2:84649822-84649844 AAGTGGGAGCTGAAAAATGATGG + Intronic
933750480 2:85599781-85599803 AAGAGGGAGAGGAAGGAAGAGGG - Intronic
933975375 2:87504945-87504967 TGGTGGGAGCTAGAGGAACAGGG + Intergenic
934489451 2:94750353-94750375 AAGTGGGAGCTAAGCTATGAGGG + Intergenic
934900268 2:98154420-98154442 ATGTGTGCGCTAAGGGAAGAGGG - Intronic
936081176 2:109433736-109433758 AAGCGGGGGCTAAGGGATGATGG + Intronic
936318451 2:111445868-111445890 TGGTGGGAGCTAGAGGAACAGGG - Intergenic
937305639 2:120868864-120868886 AAAGAGGAGCTCAAGGAAGAGGG + Intronic
937697682 2:124826403-124826425 GAGTGGGAGGTAAAGAGAGAAGG + Intronic
938113842 2:128590284-128590306 GAGAGGGAGCAAAAGGGAGAGGG - Intergenic
938498392 2:131816816-131816838 AAGTGGGAGCAAAAGAGAGTGGG + Intergenic
938755958 2:134379084-134379106 AAGTGGGAGAAAAAGCCAGAAGG - Intronic
939152128 2:138485511-138485533 AAGTGGGAGCTGAGAGAAGGAGG + Intergenic
939655484 2:144819007-144819029 AACTGGGAGCTGAAAGAAAAAGG - Intergenic
940125808 2:150322748-150322770 AAGTGGGAGCTAAGCTATGAGGG - Intergenic
940293721 2:152101272-152101294 AACTGGGAGCTGAAGGGTGAGGG - Intergenic
940822844 2:158376672-158376694 TAGAGGGAGGGAAAGGAAGAGGG + Intronic
941060468 2:160841814-160841836 AAATGGGAGAGAGAGGAAGATGG + Intergenic
941162057 2:162046660-162046682 AAGAGGGAGGCAAATGAAGATGG + Intronic
941178162 2:162225722-162225744 AAGTTGGTGGTAGAGGAAGAAGG + Intronic
942468895 2:176239091-176239113 AGGTGGGAGCAAAGGGAAAATGG - Intergenic
942762860 2:179420408-179420430 AAGTGGGAGCTAAATGATGAGGG + Intergenic
943735272 2:191347156-191347178 AAACGGGATCTAAAAGAAGAAGG - Intronic
944248791 2:197560449-197560471 TAGTGAAAGCTAAAGGCAGATGG - Intergenic
944832132 2:203543400-203543422 CAGTAGGAGTTAAGGGAAGAGGG + Intergenic
945396559 2:209325321-209325343 AGGAGGGAGCTAAGTGAAGATGG - Intergenic
945504717 2:210625621-210625643 TCATGGGAGCCAAAGGAAGAAGG + Intronic
945609772 2:211985257-211985279 AAGAGGGAAGTAAAGAAAGAAGG + Intronic
946353753 2:219172233-219172255 AGGTGGGAGATAAGGGAAGTGGG - Exonic
947126150 2:226870429-226870451 AAGTAGGAGCAAAGGGAAGTAGG - Intronic
947584476 2:231345093-231345115 AAGTCAGGGCTAAAGGAAGCGGG + Exonic
947648101 2:231759677-231759699 AAGAGGGAGTTGATGGAAGATGG - Intronic
948046306 2:234948040-234948062 AAGTGGGAGCAAGAGAAAGAGGG + Intergenic
948377413 2:237530591-237530613 AAGTGGGCCCTCAAGGAAGTTGG - Intronic
948752867 2:240142528-240142550 AGGTGGGAGCTAGATGCAGAGGG + Intronic
1168795033 20:605655-605677 AAGTGGCAGCCATTGGAAGATGG + Intronic
1169530892 20:6483775-6483797 CAGTTGGAGCTAATGGTAGAGGG + Intergenic
1169810795 20:9607271-9607293 AAGTGTCAGCCAAAGGAAAATGG + Intronic
1169909856 20:10639193-10639215 AAGTGGGAGCTCAAAGACCAGGG + Exonic
1169934831 20:10872095-10872117 AAGTGGGAGCTCTAGGAAGGAGG - Intergenic
1170763439 20:19271769-19271791 AAGTGGGAGCTAAGCTATGAGGG + Intronic
1170938122 20:20827198-20827220 CAGTGGGAACTCAGGGAAGAGGG + Intergenic
1171221384 20:23401072-23401094 AAGAGGGAGCTGAAGGAAGCAGG + Intronic
1172134779 20:32679643-32679665 CAGTGGGAGCTAAGGGGAGGAGG - Intergenic
1172320353 20:33991647-33991669 AAGTGGGACGTACAGGGAGATGG - Intergenic
1172629378 20:36367754-36367776 AAGTGGGAGCTGGAGGAGCATGG - Intronic
1172726192 20:37043874-37043896 AAGTGATAGCTAAAGGATGTAGG + Intronic
1173215047 20:41073294-41073316 AGGTGGAACTTAAAGGAAGATGG + Intronic
1173430707 20:42985054-42985076 AACTGGGAGCTACAGCAGGAGGG + Intronic
1174383202 20:50170905-50170927 CAGAGGGAACGAAAGGAAGAGGG + Intergenic
1175284661 20:57830093-57830115 AAGTGCTTGTTAAAGGAAGAGGG - Intergenic
1175700380 20:61132555-61132577 AAGTGGGAGCTAAAGCTATGAGG - Intergenic
1176840505 21:13838501-13838523 AAGTGGGAGCTAAGCTATGAGGG + Intergenic
1176974349 21:15302006-15302028 AAGTGGGAGTTAAAGCACAAAGG - Intergenic
1176996676 21:15562862-15562884 AACTGAGACCTAAAGGAGGAAGG + Intergenic
1177636913 21:23799165-23799187 ATCTGAGAGCAAAAGGAAGAGGG + Intergenic
1177660225 21:24073329-24073351 GAATGGGAGGTGAAGGAAGAAGG - Intergenic
1177991997 21:28047953-28047975 CATTGTGAGCTCAAGGAAGAAGG - Intergenic
1178008809 21:28258162-28258184 AATTGGGAGCTAAGGGTAAAAGG + Intergenic
1178363083 21:31966117-31966139 AAGTGGGAGCTAAGCTATGAAGG - Intronic
1178497785 21:33101730-33101752 AAGTGGGAGCTGAAGGGACTTGG + Intergenic
1179065366 21:38019773-38019795 AAGAAGGAACTACAGGAAGAAGG + Intronic
1179965278 21:44801363-44801385 CAGTGAGAGCTTGAGGAAGAAGG - Intronic
1180157677 21:45986035-45986057 AAGTGGGAGCAGCAGGAAGGAGG - Intronic
1180499536 22:15920013-15920035 AAGTGGGAGCAAAAGAGAGTGGG + Intergenic
1181018675 22:20086585-20086607 AATTTGGAGCTAGATGAAGAAGG + Exonic
1182837644 22:33357283-33357305 AAGTGGGAGCTAAATAGTGAGGG + Intronic
1183104177 22:35604364-35604386 AGGTGAGAGCAAAAGGAATAAGG - Intergenic
1183204059 22:36406343-36406365 AAGTGGGTCCTAGAGGCAGATGG - Intergenic
1183738252 22:39655715-39655737 AAGTGGGAGCCCAAGGAGGAGGG - Intronic
1183769988 22:39915999-39916021 ATGGGGGAGCTTAAGCAAGAGGG - Intronic
1184560568 22:45260703-45260725 AAGTGAGGGCTACAGGAAGAGGG + Intergenic
1184818138 22:46887910-46887932 CAGTGGAAGCTTAAGGAGGATGG + Intronic
1184829683 22:46976671-46976693 AAGAGGGTGCTTAAGGAAGATGG - Intronic
1184926083 22:47639135-47639157 AATTGGGGGTGAAAGGAAGAGGG + Intergenic
1185209477 22:49561634-49561656 AAGTGGGAGAGACAGGAACAGGG + Intronic
950357695 3:12425617-12425639 GGGTGGGAGGTAGAGGAAGAAGG - Intronic
950467281 3:13162905-13162927 GAGTGGGAGCTAAAGGGATAAGG - Intergenic
950907692 3:16553942-16553964 AAGAGGGTGCCAAAGGAAGCAGG + Intergenic
950969721 3:17174185-17174207 GAGTGAGAGATAAAGCAAGAGGG - Intronic
951034793 3:17921227-17921249 AAGAGGGAGCCATGGGAAGATGG + Intronic
951093924 3:18606638-18606660 AGGTGGCAGATTAAGGAAGAAGG - Intergenic
951407069 3:22314330-22314352 AAGTGGGAGCTAAGCTATGAGGG - Intronic
952342470 3:32457656-32457678 AAGTAGTAGCTAATGGATGATGG + Intronic
952443668 3:33359255-33359277 AGGTGGGAGGTAAAGGAAGAGGG - Intronic
952654000 3:35761685-35761707 AAGTGGAAGCTAAGATAAGATGG + Intronic
953911228 3:46894008-46894030 AGGTGGGGGTCAAAGGAAGAGGG + Exonic
954125932 3:48528865-48528887 TAGTGGTAGCTTAAGGCAGAAGG + Intronic
954764208 3:52899009-52899031 ATGTGGGAGCAAGAGGGAGAGGG - Intergenic
955189482 3:56747161-56747183 AAGTGGAAATTAAATGAAGAGGG - Intronic
955995250 3:64673992-64674014 AAGTGGGAACAAATGAAAGAAGG + Intronic
956657104 3:71563074-71563096 AAGTGGGAGCAAACTGCAGAGGG + Intronic
956778617 3:72587160-72587182 ATGGGGGAGCTGAAGGGAGATGG - Intergenic
956780824 3:72601752-72601774 AAGAAGGGGCAAAAGGAAGAAGG + Intergenic
957424181 3:80016004-80016026 AAGTGCAAACTAAAGGCAGATGG + Intergenic
958145079 3:89613536-89613558 GACTGGGAGCTAAAGGAAGAAGG + Intergenic
958152569 3:89709605-89709627 AAGTGGGAGCTAAGCTATGAAGG + Intergenic
959347637 3:105219218-105219240 AAGTGGGAGCTAAGCTATGAGGG - Intergenic
959548275 3:107623445-107623467 ATGTGGCAGCTAAAAGTAGAAGG - Intronic
959717610 3:109450255-109450277 AAGAGGGAGAGAAAGAAAGAGGG + Intergenic
961126549 3:124423760-124423782 AATTGGGAGGCTAAGGAAGAAGG + Intronic
961973123 3:130991214-130991236 TAGTGGAAGCCAAGGGAAGATGG + Intronic
962034933 3:131641939-131641961 ATGTGGGAGCTAAACTATGAGGG + Intronic
962436072 3:135367890-135367912 AAGTTGAAGCGAATGGAAGATGG - Intergenic
962542001 3:136391729-136391751 CAGAAGGAGCTGAAGGAAGAAGG + Intronic
963271166 3:143287080-143287102 AAGTGGGACCAGAAGGAAGGAGG - Intronic
963688062 3:148463200-148463222 AAGTGGGAGCTAAGCTATGAGGG + Intergenic
963794368 3:149616900-149616922 AAGTGGAAGAAAAAGTAAGAAGG + Intronic
964051410 3:152398543-152398565 AAGTGGGAGATTATGAAAGATGG + Intronic
964325438 3:155541168-155541190 AAGTGGGAGCTAAGCTATGAGGG + Intronic
964560997 3:157996520-157996542 AAGTGGAAGCAGAAGGCAGAAGG + Intergenic
964675930 3:159279800-159279822 AAAAGGGAACTAAAGGAAGTTGG + Intronic
964876490 3:161373107-161373129 CAGAGGAAGCTAAAGGTAGATGG + Intergenic
965250829 3:166342318-166342340 AAGTGGGAGGAAAAGTAAAAGGG + Intergenic
965435385 3:168644395-168644417 AAATGGGAGAAAGAGGAAGAGGG - Intergenic
966153881 3:176894962-176894984 AAGTGGGAGCTAAGCTATGAGGG + Intergenic
966265302 3:178034245-178034267 AGGTGGGAGCTAAAGAGAGCCGG + Intergenic
966400715 3:179544415-179544437 GAGTGGGATTTAAAGGAGGAAGG + Intergenic
967391185 3:188956396-188956418 AAGTGGGGGATGAAGAAAGAGGG - Intronic
967761044 3:193226627-193226649 AGCTGGGAGCTAAAAGGAGAGGG + Intergenic
969120472 4:4905333-4905355 ATGTGGGAGCTAAAGAAAAGTGG - Intergenic
969154527 4:5198696-5198718 AAGAGGCAGATAAAGGAGGAAGG + Intronic
969450113 4:7268212-7268234 AAGTGGGAGTGAAGGGATGAAGG + Intronic
969508022 4:7600172-7600194 AATTAGAAGCTAAAGAAAGAGGG - Intronic
969537786 4:7767270-7767292 AAGAGGGAGCAAAAGGGAGCGGG + Intronic
970189022 4:13492712-13492734 AAGAGGAAGGTAAAAGAAGATGG + Intergenic
970540503 4:17073727-17073749 AAATGGCAGCTAAATGAACATGG - Intergenic
970630764 4:17941545-17941567 AAGTGGAAGCTAGATGAAGCAGG - Intronic
970718678 4:18959526-18959548 AAGTGGGAGATAATGGAATCAGG - Intergenic
970728374 4:19074070-19074092 AATTGGAAGGCAAAGGAAGAAGG - Intergenic
971100487 4:23461065-23461087 AAGTGGGAGTTAAAAAAAAATGG + Intergenic
972034883 4:34507218-34507240 AGGTGGGAGGTTGAGGAAGAGGG - Intergenic
972065986 4:34944759-34944781 AAGGGGGAGATAAAGAAAGCTGG - Intergenic
972697701 4:41464209-41464231 AAGTGTGAGGGACAGGAAGAAGG - Intronic
972704107 4:41524362-41524384 AAGTGAGACATAAAGCAAGATGG - Intronic
973169499 4:47121538-47121560 GAGTGGGAGGTGAAGCAAGATGG - Intronic
974188683 4:58474803-58474825 AAGTGGGGGCTGAGGGATGAGGG + Intergenic
974678510 4:65129708-65129730 TGGTGGGAGGTAAAGGAAAATGG - Intergenic
975425601 4:74223399-74223421 AAGTAGGAGCTAAATGATGAGGG + Intronic
975506750 4:75146748-75146770 AAGTGCTGGCTAAAAGAAGAAGG - Intergenic
975511935 4:75203645-75203667 AAGTGGGAGCTAAATAAAGTGGG - Intergenic
975615483 4:76242324-76242346 CAGTGGGAGCAAGAGAAAGAGGG - Intronic
975692324 4:76978269-76978291 ACGTGGGAGCTACGGGAAGTGGG - Intronic
975928317 4:79487004-79487026 AAGTGGGAGCTAAGCTATGAGGG - Intergenic
976122842 4:81801674-81801696 AAGTTGGAGGGAAAGGTAGAAGG + Intronic
976517609 4:85986931-85986953 CAGTGGGAGCTCAGGGAGGAAGG + Intronic
976519385 4:86008538-86008560 AAGCTGGAGTTCAAGGAAGAGGG - Intergenic
976772970 4:88674223-88674245 AGGTGGGGGTTACAGGAAGAGGG + Intronic
977739323 4:100458639-100458661 AAGGGGGACCTAAAGTCAGAAGG + Intronic
977749054 4:100586790-100586812 AAGTTGGAGCCCAAGGAAGGGGG + Intronic
978052184 4:104215173-104215195 GAGGGGGAGGAAAAGGAAGAAGG + Intergenic
978200447 4:106018907-106018929 AAGAAGGAGCTACAGGCAGAAGG - Intergenic
978386465 4:108180450-108180472 AAGAGGAAGCAAAAAGAAGAGGG + Intergenic
978685077 4:111431190-111431212 ATGTGGGGGCTGAGGGAAGAGGG + Intergenic
978782682 4:112573335-112573357 AAGTGGGAGCTAAGTTATGAGGG + Intronic
979199874 4:117964523-117964545 AAATGGAAGCTGAAGGATGAGGG - Intergenic
980760706 4:137230145-137230167 AAATGGGAGCAAAAGAGAGAAGG + Intergenic
981365881 4:143902609-143902631 GAGAGGGAGAGAAAGGAAGAAGG - Intronic
981528599 4:145732150-145732172 ATGTGGGAACTAAAGGAATTAGG + Intronic
981676260 4:147346443-147346465 AAGTGGGTGGTAAAGGCACAAGG + Intergenic
982805574 4:159758672-159758694 AGGTGGGAGCTAAAAGAGGAGGG + Intergenic
983029445 4:162781195-162781217 CACTGAGACCTAAAGGAAGAGGG - Intergenic
983281065 4:165681315-165681337 AAGTTGGACCTAGAGGATGAAGG + Intergenic
983422566 4:167538655-167538677 ATGTGGGAGCTAAACTAAGGGGG + Intergenic
983447299 4:167869552-167869574 ACGTGGAAGCTAAATGATGAGGG - Intergenic
983523496 4:168735859-168735881 ATGTGGGAGGTAGAGGAACAGGG - Intronic
983539332 4:168891608-168891630 AAGTGGGAAAGAAAGGAAGAAGG + Intronic
984535534 4:180970070-180970092 AAGTAGCAGCAAAAAGAAGAGGG - Intergenic
986798316 5:11233852-11233874 AAGTGTTAGCCAAAGGAACATGG - Intronic
987246504 5:16054382-16054404 AAGGGGGAACAAAAGGAAGAAGG + Intergenic
988088152 5:26498351-26498373 AAGTGAGAGGTAAAGGAAACTGG - Intergenic
988378184 5:30466330-30466352 AATGGGGAGCAAAAGAAAGAAGG + Intergenic
989239693 5:39189659-39189681 AAGGGTGAGCTACAGGGAGAAGG + Intronic
990590940 5:57263899-57263921 AAGGGGGAGCTAAAAGCAAATGG - Intronic
990928005 5:61051556-61051578 ATGTGGGAGAAAAAGAAAGAAGG - Intronic
991278824 5:64885668-64885690 AAGAGGGAGGGAAAGAAAGAGGG - Intronic
992030975 5:72721315-72721337 AAGAGGGAGGGAAAAGAAGAAGG - Intergenic
993052315 5:82939884-82939906 AAGGGGGAGGGAGAGGAAGAGGG - Intergenic
993835301 5:92812476-92812498 AAAGAGGAGCAAAAGGAAGAAGG + Intergenic
994630234 5:102276225-102276247 AAGTGGATGCTAAAGAAGGAGGG - Intronic
994667098 5:102718353-102718375 AAATGGGAGCAAAAGGAAATAGG + Intergenic
995011851 5:107265260-107265282 AGGGGGAAGCCAAAGGAAGAGGG - Intergenic
995246202 5:109938177-109938199 CAGTGGGAGCTACAGAAACACGG - Intergenic
995318879 5:110808175-110808197 TGGTGGCAGCTACAGGAAGATGG + Intergenic
996226747 5:121008570-121008592 AAGTGGTAGCTAGAGGAATTTGG + Intergenic
997294354 5:132760483-132760505 AAGTTGGAGGAAGAGGAAGAAGG + Intronic
997496036 5:134327042-134327064 AACTGGGAGCTGGAGGAAGAGGG - Intronic
998238812 5:140423923-140423945 GAGAGAGAGCTAATGGAAGAGGG - Intronic
998383788 5:141744243-141744265 AAGAGGGAGGTAATGGGAGAGGG + Intergenic
998749538 5:145303994-145304016 AAGTGGGAGATAGATTAAGAAGG - Intergenic
998833822 5:146185335-146185357 GGTTGGTAGCTAAAGGAAGAGGG - Intergenic
999467824 5:151823675-151823697 AAGTTGGAGCCAAATGATGAAGG - Intronic
1000019300 5:157304964-157304986 AAGTGGGAGCTAAGCTACGAGGG - Intronic
1000680185 5:164174166-164174188 AAGTGGAAGGGCAAGGAAGAAGG + Intergenic
1001287391 5:170433948-170433970 AAATGGGAGCTAAAGTGAGCAGG - Intronic
1001313641 5:170628022-170628044 AAGCAGGAGCAGAAGGAAGAGGG - Intronic
1002012818 5:176297570-176297592 GAGTTGGTGCTACAGGAAGAAGG + Intronic
1002356562 5:178634189-178634211 TAGTTGAAGCTAAAGGAAAAGGG + Intergenic
1003099232 6:3164409-3164431 AAGAAGGAGATTAAGGAAGATGG + Intergenic
1003128609 6:3376431-3376453 AAATGGGAGCTACAGGATGTCGG - Intronic
1003354569 6:5355118-5355140 AGGTGGGAGCTACAGGAAGTAGG - Intronic
1003982193 6:11400554-11400576 ATGTGGGAGCTAAAAAAAAATGG + Intergenic
1004615341 6:17282642-17282664 AAATGGGAGATCAAGGAGGAGGG + Intronic
1005259596 6:24043550-24043572 AGGTGGGAGTCTAAGGAAGATGG - Intergenic
1005392338 6:25346224-25346246 AAGTGGGAGATGAAGCCAGAGGG - Intronic
1005633188 6:27728301-27728323 AACAGGAGGCTAAAGGAAGAAGG - Intergenic
1006026642 6:31151175-31151197 AAGTGGGAGTGAAGGGAACAAGG - Intronic
1007825702 6:44599086-44599108 GAGGGGGAGCTGAAGGGAGAGGG - Intergenic
1007978869 6:46130090-46130112 AAGGGGGACCTGGAGGAAGAGGG - Exonic
1008133045 6:47740056-47740078 AAGTGGGAGCAAATGAGAGAGGG + Intergenic
1008296075 6:49779289-49779311 AATGGGGAGGGAAAGGAAGATGG - Intergenic
1010440415 6:75887671-75887693 AAGTTGGAGCAAAAAGAAAATGG + Intronic
1010734842 6:79432281-79432303 AAGGGGTAGATAAAGCAAGAAGG + Intergenic
1011059538 6:83248896-83248918 AATTGTGAGCTATAGAAAGATGG - Intronic
1011782058 6:90800558-90800580 TTGTGAAAGCTAAAGGAAGAAGG + Intergenic
1011962623 6:93109935-93109957 ATGTAGGAGTTAAAGGAACAGGG - Intergenic
1012032424 6:94088571-94088593 AAGTGGAATCTTAAGAAAGATGG + Intergenic
1012611166 6:101222691-101222713 ATGTGGGAGCTAAAAAAAAATGG - Intergenic
1013381363 6:109574916-109574938 AAGTGAGAGCTAAACTATGAGGG - Intronic
1013572920 6:111448178-111448200 AAGTGAGAGCCAAAGGCAAATGG + Intronic
1014450257 6:121573594-121573616 AAGTTGGAGATAAAGGAAGAAGG + Intergenic
1014760677 6:125353381-125353403 AAGGGTGAGGAAAAGGAAGAAGG + Intergenic
1015218769 6:130780624-130780646 CAGTGTGACCTATAGGAAGATGG + Intergenic
1015552416 6:134426017-134426039 ATGTGGGAGCTAAGGTAGGAAGG - Intergenic
1015872880 6:137794787-137794809 AAGTGGGAAGAAAAGGAGGAAGG + Intergenic
1015917167 6:138228912-138228934 AAGTCAGAGCTAAGTGAAGAGGG + Intronic
1016224772 6:141721970-141721992 AAGTAGGAGGTAAGTGAAGAAGG - Intergenic
1016755357 6:147678708-147678730 AAATGGGAGTTCATGGAAGAGGG + Intronic
1017276437 6:152574479-152574501 AAGTGAGAGCAAGAGGAGGAAGG - Intronic
1017636565 6:156449739-156449761 ACATGGGAACTAAAGGAAGTAGG + Intergenic
1017964990 6:159256394-159256416 ATGTGGGAACTACAGGAAGGAGG - Intronic
1018219774 6:161566351-161566373 ACCTGGGAGCCAAAGGAAGAAGG - Intronic
1018784732 6:167099117-167099139 CAATGGGAGCAAGAGGAAGAAGG + Intergenic
1020080145 7:5282581-5282603 AGGTGGGAGGTGGAGGAAGAGGG + Intronic
1020213125 7:6170122-6170144 AGGTGGGAGCCACAGGCAGAAGG + Intronic
1020701557 7:11490150-11490172 AAGTGGGTGCTATCAGAAGAAGG - Intronic
1021024576 7:15648868-15648890 AAGTGGGTGCCAAAGGAAGAGGG - Intronic
1021763242 7:23921717-23921739 AAGTGGGATTTAGAGGCAGAGGG + Intergenic
1023457560 7:40358168-40358190 ATGTGGGAGCTTAAAGATGATGG + Intronic
1023515407 7:40996732-40996754 AATTGGGAGCTGAAGGAAGGTGG - Intergenic
1024684128 7:51726471-51726493 GGGTGGCAGCTCAAGGAAGAGGG - Intergenic
1026145133 7:67740095-67740117 AAGTGGGAGGTACAGGAGGCAGG - Intergenic
1026183489 7:68062691-68062713 GAGTGGGGGCAAGAGGAAGAGGG + Intergenic
1027238777 7:76314046-76314068 GGGTGGGAGCTCAGGGAAGACGG - Intergenic
1027592436 7:80134275-80134297 AAGAGGGAGGGATAGGAAGAAGG + Intronic
1028099592 7:86803616-86803638 AAGTGGCAGCAAAAAGTAGAAGG - Intronic
1028181936 7:87734439-87734461 AGTTGGTAACTAAAGGAAGAAGG - Intronic
1028340590 7:89715259-89715281 AAATGTGACCTAAAGGTAGAAGG - Intergenic
1029473341 7:100768148-100768170 AGGTAGGAGTTAAGGGAAGACGG + Intronic
1030310479 7:108063994-108064016 AAGTGGGAGGAAAAGGAATGGGG + Intronic
1030382884 7:108833181-108833203 ATGTGGGAGCAAAATAAAGATGG - Intergenic
1031214865 7:118877278-118877300 AACTGGAAGATAAAGGAAAAAGG + Intergenic
1032604144 7:133330747-133330769 AAGGGCGAGCCAAAGCAAGATGG - Intronic
1032727452 7:134604093-134604115 AAATGGAGGATAAAGGAAGATGG - Intergenic
1034333398 7:150303641-150303663 AAATGGGAGGTTGAGGAAGACGG - Intronic
1034523979 7:151643001-151643023 AAGAAGGAGCTCAAGGAACATGG + Intronic
1034664642 7:152806246-152806268 AAATGGGAGGTTGAGGAAGATGG + Intronic
1034822164 7:154226116-154226138 AAGTGGGAGGAAGAGGAACAGGG + Intronic
1034827269 7:154277083-154277105 TAGTATGAGCTAAAGCAAGAAGG + Intronic
1034874834 7:154716064-154716086 AAATGAGATCTAAAAGAAGATGG - Intronic
1035080315 7:156210258-156210280 AAGTGGGGGCTGAGGGAAAATGG + Intergenic
1035827740 8:2662316-2662338 CAGTGGGAGACAGAGGAAGAGGG - Intergenic
1037297282 8:17413969-17413991 CAGTTGGAGCTAAATAAAGAGGG - Intergenic
1037625910 8:20606838-20606860 AAGTGGGAGCTAAGCCATGAGGG - Intergenic
1038132605 8:24749901-24749923 GAGTGGGAGCAAAAGAGAGAAGG + Intergenic
1038149991 8:24934342-24934364 TAGTGGGAGCAAAAGACAGAAGG - Intergenic
1038397727 8:27259328-27259350 AAGTGGGAGCTAAGCTAGGAGGG - Intergenic
1038474630 8:27856537-27856559 AAGTGGGAGCCGACGGGAGAGGG - Intergenic
1038688444 8:29739777-29739799 CAGTGGGGGTTGAAGGAAGAGGG + Intergenic
1038770415 8:30473870-30473892 AAGTGGGAGCTGAAGGATGAGGG + Intronic
1038881853 8:31623316-31623338 AAGTGGGAATGAAAGGATGAAGG + Intergenic
1039029885 8:33298004-33298026 AAGGAGGAGATAAAGGAAAAGGG + Intergenic
1039397761 8:37241684-37241706 AAGTGGGAGCTAAGCTATGAGGG + Intergenic
1039789495 8:40863428-40863450 ATGAGGTAGCTAAAGGGAGAAGG + Intronic
1039826945 8:41182802-41182824 GAATGGGAGCCCAAGGAAGAAGG - Intergenic
1040564274 8:48552149-48552171 AAGGAGGAGCGAAAGGAGGAGGG - Intergenic
1041415243 8:57600733-57600755 ATGTGGGAGCTAAAAAAAGTTGG + Intergenic
1041430248 8:57773415-57773437 AAGTGGGAGCTAAACATTGAGGG + Intergenic
1041979778 8:63844369-63844391 CAGTGGGAGGTAGAGGAAGTGGG - Intergenic
1042875945 8:73440105-73440127 AAGTAGGAGGAAAAGCAAGATGG - Intronic
1043144464 8:76635146-76635168 AAGTGGGAGCTAAGCTATGAGGG + Intergenic
1043159316 8:76826160-76826182 GAGTGGGATCAAAAGGGAGAGGG + Intronic
1043652016 8:82607995-82608017 AAGTGGGAGCTAAACAATGGGGG - Intergenic
1043731591 8:83690728-83690750 AAGTGGGAGCTAAACATGGAGGG + Intergenic
1043861829 8:85326623-85326645 AGGTGGGAGCCAAAGAAAGAGGG - Intergenic
1045502615 8:102755168-102755190 AAGAGAGAGATAAAAGAAGAAGG + Intergenic
1045605273 8:103766899-103766921 AAGTGGGAGTTAAGGTAATAGGG + Intronic
1046404848 8:113760098-113760120 AAGTGGTAGAGAAAGGGAGAAGG - Intergenic
1046581752 8:116101888-116101910 TTGAGGGAGATAAAGGAAGAGGG - Intergenic
1047540549 8:125761442-125761464 AAGGTAGAGATAAAGGAAGAAGG - Intergenic
1047578137 8:126181228-126181250 CAGTGGAAGCTAAAGAAAGCAGG + Intergenic
1048007661 8:130432085-130432107 AAGGGGGAGGAAAGGGAAGAGGG + Intronic
1048526534 8:135208088-135208110 AAATGGGAGTTAAATGAGGAAGG + Intergenic
1048979990 8:139698043-139698065 AGGGTGGAGCTAAAGGGAGAAGG + Intronic
1049311771 8:141937360-141937382 AGGTGGGAGGGAAGGGAAGAGGG - Intergenic
1049501508 8:142970222-142970244 AAGTGGTAACAAAAGGAAGTGGG + Intergenic
1049702804 8:144022770-144022792 AAGTGGGTCCTCAGGGAAGAGGG - Intronic
1050167131 9:2777042-2777064 AAGTGGGAGCTGAACAATGAGGG + Intronic
1050191255 9:3029007-3029029 AACTGTGAACCAAAGGAAGAAGG + Intergenic
1050409160 9:5343666-5343688 AAGTGGGAGCTAAGCTATGAGGG + Intergenic
1051443709 9:17116830-17116852 ACGTGAGAGCAAGAGGAAGAGGG - Intergenic
1051540218 9:18207196-18207218 AAATGGAAGGGAAAGGAAGAAGG + Intergenic
1052002870 9:23308150-23308172 AGGGGGGAACTAAAGGAATAGGG - Intergenic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1054858188 9:69923712-69923734 CACTGGGAGCTAGAGGGAGAGGG - Intergenic
1055332014 9:75194599-75194621 AAGTGGGAGGTAGAGGGAGAGGG + Intergenic
1055966007 9:81865903-81865925 AAGTGGGAGCTAAGCTATGAGGG - Intergenic
1056536558 9:87533038-87533060 AGGTGGGAGTTAAAAGCAGATGG + Intronic
1056563638 9:87755097-87755119 AAGAGGGAGCTAAGGCAAGAGGG - Intergenic
1057842041 9:98494294-98494316 AAGTGGGAGTTGGAGGAACAGGG + Intronic
1058170460 9:101674349-101674371 AAGAGGAAGCAAAAGAAAGAAGG - Intronic
1058314293 9:103544847-103544869 TACTAGGAGCTAAAGTAAGAAGG + Intergenic
1058460151 9:105175022-105175044 AAGTGAGAGCGAGAGGGAGAGGG - Intergenic
1058485861 9:105442877-105442899 TGGTGGAAGCTACAGGAAGATGG - Intergenic
1058742055 9:107953550-107953572 AAGTGGGAGTTAAAGAGAGCTGG + Intergenic
1059503508 9:114777204-114777226 GAGTGAGAGAGAAAGGAAGAAGG - Intergenic
1059836269 9:118157419-118157441 AAGTGCAATCTGAAGGAAGAAGG + Intergenic
1060213032 9:121722067-121722089 AGGCAGGAGCTCAAGGAAGAAGG + Intronic
1060380241 9:123163141-123163163 AAGAGGGAGACAATGGAAGAGGG + Intronic
1060822005 9:126666525-126666547 AATTGAGGGCAAAAGGAAGAAGG + Intronic
1060993532 9:127862417-127862439 AAGTGGGAGAGGAAGGAAGTGGG - Intergenic
1061237531 9:129351479-129351501 AAGGGGGAGGAAAAGGAAGGGGG + Intergenic
1062199080 9:135291498-135291520 GTGTGAGAGATAAAGGAAGAAGG + Intergenic
1062691363 9:137843433-137843455 AAATGGGAACTAAATGATGAGGG - Intronic
1186336513 X:8595483-8595505 AAGTGGGAGCTAAAGGAAGATGG + Intronic
1186864005 X:13701204-13701226 CAGTGGCAGGTAAAGGAGGAGGG - Intronic
1187030186 X:15478777-15478799 AAGTGTGAGCAGAAGGCAGAGGG - Intronic
1187365625 X:18663727-18663749 TGGTGGAAGCTAAAGGAAGATGG - Intronic
1187386509 X:18853490-18853512 AAATGGAAGCTAAAGAGAGAGGG - Intergenic
1188080246 X:25829784-25829806 AAGTGGATTCAAAAGGAAGACGG - Intergenic
1188687511 X:33086832-33086854 TAGAGGGAGATAAAGGAAGGGGG + Intronic
1188744090 X:33820443-33820465 AAGTGGGAGCAAAAGAGAGAGGG - Intergenic
1188903263 X:35761320-35761342 AAGTGGGGGCTCAAACAAGATGG - Intergenic
1189265018 X:39708482-39708504 AACTGGAAGCTAAAAGATGATGG + Intergenic
1189797059 X:44655186-44655208 AAGAGGGATCTAAAGACAGAAGG + Intergenic
1189935664 X:46065940-46065962 AAGTGGGAGCTAAATGATGAGGG - Intergenic
1190535127 X:51418322-51418344 AAGGGGAAGCTAGTGGAAGAAGG - Intergenic
1191699496 X:64024539-64024561 AACTGGGGGCTGAGGGAAGATGG - Intergenic
1192904358 X:75534549-75534571 AAGTGGGAGCTAAGCTATGAGGG - Intergenic
1192944605 X:75951638-75951660 AAGTGGGAGCTAAGCTATGAGGG - Intergenic
1193181265 X:78459966-78459988 AAGTGGAAGCTAAAAAAAAAGGG - Intergenic
1193677025 X:84467237-84467259 TGGAGGGAGCTAAAAGAAGATGG + Intronic
1193680760 X:84516341-84516363 AAGTGGGAGCTAAACTATGAGGG - Intergenic
1194954875 X:100166990-100167012 AAGAGGGAGGTGAAGCAAGATGG - Intergenic
1194961302 X:100238738-100238760 AAGTGGGAGCTAAAAATTGAGGG - Intergenic
1195173132 X:102288397-102288419 AAGTGGGAGCTAACCTATGAGGG - Intergenic
1195185734 X:102398698-102398720 AAGTGGGAGCTAACCTATGAGGG + Intronic
1195283234 X:103357256-103357278 AAGGGGGAGAGAAAAGAAGAGGG - Intronic
1195999752 X:110769235-110769257 AAGTGGGAGATAGAAGAGGATGG - Intronic
1196298642 X:114029259-114029281 AAGAGAGACTTAAAGGAAGAAGG + Intergenic
1196556824 X:117097433-117097455 AAGTGGAAGCTAAAAAAAGGAGG - Intergenic
1196938075 X:120749383-120749405 AAGTGGGAGGGGAAGGAAGAGGG + Intergenic
1197169949 X:123421708-123421730 CAGTGGGAGCTGAGGGAAGGTGG - Intronic
1197966340 X:132066594-132066616 AACTGGGTGCTAGAGGAGGATGG - Intergenic
1199680936 X:150224163-150224185 AAGAGGAAGATGAAGGAAGAAGG - Intergenic
1199904304 X:152208731-152208753 AAGAGGGAGCAAAAGAGAGAAGG - Intronic
1201426884 Y:13860916-13860938 AAGTGAGAGCTAAAAGAAGATGG - Intergenic
1201741233 Y:17326221-17326243 AAGTGAGAGAGAAAGAAAGAAGG + Intergenic
1202274009 Y:23097192-23097214 AAGAGGGTGCCAAAGGAAGCAGG + Intergenic
1202292017 Y:23323485-23323507 AAGAGGGTGCCAAAGGAAGCAGG - Intergenic
1202427005 Y:24730937-24730959 AAGAGGGTGCCAAAGGAAGCAGG + Intergenic
1202443786 Y:24939157-24939179 AAGAGGGTGCCAAAGGAAGCAGG - Intergenic