ID: 1186344261

View in Genome Browser
Species Human (GRCh38)
Location X:8675333-8675355
Sequence CTTTCTCTGCTGAGCGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 197}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186344261_1186344266 22 Left 1186344261 X:8675333-8675355 CCTGCCACGCTCAGCAGAGAAAG 0: 1
1: 0
2: 0
3: 18
4: 197
Right 1186344266 X:8675378-8675400 CAAATCCTTTACTCTAAGAAAGG 0: 1
1: 0
2: 2
3: 21
4: 241
1186344261_1186344264 -8 Left 1186344261 X:8675333-8675355 CCTGCCACGCTCAGCAGAGAAAG 0: 1
1: 0
2: 0
3: 18
4: 197
Right 1186344264 X:8675348-8675370 AGAGAAAGGCAGCATCTCAAAGG 0: 2
1: 0
2: 1
3: 28
4: 389
1186344261_1186344268 27 Left 1186344261 X:8675333-8675355 CCTGCCACGCTCAGCAGAGAAAG 0: 1
1: 0
2: 0
3: 18
4: 197
Right 1186344268 X:8675383-8675405 CCTTTACTCTAAGAAAGGCATGG 0: 1
1: 1
2: 0
3: 9
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186344261 Original CRISPR CTTTCTCTGCTGAGCGTGGC AGG (reversed) Intronic
900816725 1:4852975-4852997 CTTGCTCTGCTCAGCATGGAGGG + Intergenic
901319950 1:8333778-8333800 TTTTCTCTGGTGTGTGTGGCCGG + Intronic
902771374 1:18647150-18647172 CCTCGTCTGCTGAGCTTGGCTGG + Intronic
904005164 1:27359813-27359835 CCTCATCTGCTGAGGGTGGCGGG - Intronic
904379837 1:30103249-30103271 CTTTCTCTATTGTGAGTGGCTGG + Intergenic
905168057 1:36094751-36094773 CTTTCGTGGCTGAGCATGGCAGG + Intergenic
906524207 1:46485190-46485212 CAATCTCTGCTGGGGGTGGCTGG + Intergenic
907874655 1:58473784-58473806 CTTTCTCTGCAGAGCGTTCTTGG - Intronic
907923627 1:58935691-58935713 CCTTCCCTCCTGAGCGGGGCTGG - Intergenic
907987460 1:59546402-59546424 CTTGCTCTGCAGAGGGTGGGAGG + Intronic
909931515 1:81503945-81503967 CCTTCTCTGCTGAGCATGGTTGG + Intronic
912246119 1:107964017-107964039 CTGTCGCTGCTGAGAGAGGCTGG + Intronic
916013194 1:160725319-160725341 CTTTCTCTGTTGGACTTGGCTGG + Intergenic
916143712 1:161722250-161722272 CTTCCTCAGCTGAGCCTTGCAGG + Intronic
916997456 1:170316054-170316076 GTTTCTCTACAGAGGGTGGCTGG - Intergenic
917212060 1:172641508-172641530 TTTGCTCTGCTGGGCTTGGCTGG - Intergenic
920174015 1:204089011-204089033 CTTTCTCTGCTTGGCCTTGCAGG + Intronic
920690141 1:208140056-208140078 CTATCTCTGCTCATCGTGGCTGG + Intronic
922290687 1:224206744-224206766 ATTTCTCTGCTCAGCTGGGCAGG + Intergenic
922935015 1:229415833-229415855 CTCTCCCTGCTGATCGTGTCCGG + Intergenic
923038320 1:230301053-230301075 CTTTCTCTGCTTAGCGGGCCGGG - Intergenic
923064858 1:230508282-230508304 CTGGCTGTGCTGAACGTGGCTGG - Intergenic
1063287768 10:4709071-4709093 CTTTCTCTGCAGGACATGGCAGG + Intergenic
1066393029 10:34994107-34994129 CTTTCTCTGGAGAGCTGGGCTGG - Intergenic
1070812730 10:79306411-79306433 ATTTCTGTGCTGATGGTGGCAGG + Intronic
1073030188 10:100519691-100519713 CTTTCTCGGCAGAGCGCGGAGGG - Intronic
1073444578 10:103572946-103572968 CTTTCTCTGCAGGGAGAGGCGGG - Intronic
1073709295 10:106019880-106019902 CTCTCCCTGCTGATCGTGTCTGG - Intergenic
1074219479 10:111422132-111422154 CTCTCTCTTCTGGCCGTGGCTGG + Intergenic
1074851532 10:117443124-117443146 CTTTCAATCCTGAGCGTGACCGG + Intergenic
1075074003 10:119338184-119338206 CCTTCTCTCCTGAGCCTGGTGGG + Intronic
1075372965 10:121953471-121953493 ATTTCTGTGCTGAGGGTGGTAGG - Intergenic
1076287907 10:129319070-129319092 CTTTCTGTGCTGAGAGCAGCAGG - Intergenic
1076740300 10:132479530-132479552 CTTCCTCTGCAGTGCGAGGCGGG - Intergenic
1076822234 10:132945272-132945294 CTTGCTCTTCTGAGCGGAGCCGG - Intergenic
1079254019 11:18810916-18810938 CTCTCACAGCTGAACGTGGCTGG + Intergenic
1082683697 11:56211699-56211721 CTCTATTTGCTGACCGTGGCAGG - Intergenic
1083018058 11:59476809-59476831 ATTTCGCTGCTGAGAGAGGCAGG - Intergenic
1084677719 11:70645991-70646013 CTCACACTGCTGAGCGTGGAAGG + Intronic
1084745242 11:71165939-71165961 CATCCTCTGCTGAGCGTGAGTGG + Intronic
1085934468 11:81125248-81125270 CTCTCTCTGCTGATCATGTCCGG + Intergenic
1089103306 11:115982182-115982204 CTTCCTCTGCTTGGAGTGGCTGG + Intergenic
1089866856 11:121640178-121640200 CTCTCCCTGCTGACCGTGTCCGG - Intergenic
1090386356 11:126359686-126359708 CTTTCTCAGCTGGGCGGGGCGGG + Intronic
1091691015 12:2597539-2597561 CTATCTCTGCTCTGTGTGGCTGG + Intronic
1092935473 12:13358773-13358795 CTTTCTGTGCTATGCGAGGCAGG - Intergenic
1093302517 12:17473556-17473578 CTCTCTCTGCTGATCATGTCCGG + Intergenic
1093951269 12:25166603-25166625 CTCTCCCTGCTGATCGTGTCCGG + Intronic
1101035873 12:100705839-100705861 CTTTCTTTTCTGAGGGTGGGAGG + Intergenic
1105432098 13:20345646-20345668 CTCTCTCTCGTGAGCGTGGTGGG + Intergenic
1110978678 13:81869639-81869661 CTCTCCCTGCTGATCGTGTCCGG + Intergenic
1111558628 13:89913819-89913841 CTTTCTGTGCTGAGAGCAGCGGG + Intergenic
1112889138 13:104210359-104210381 CTCTCCCTGCTGATCGTGTCCGG - Intergenic
1113074480 13:106454497-106454519 CTTTTTCTCCTGGGCATGGCCGG + Intergenic
1113634781 13:111912147-111912169 CTTTCCCTGATGAACTTGGCAGG + Intergenic
1113910788 13:113840273-113840295 CTCTCCCTGCTGGGTGTGGCGGG + Intronic
1115582373 14:34774071-34774093 CCTTCTCTGCTGAGTCTGGTTGG - Intronic
1116632392 14:47352294-47352316 CTCTCCCTGCTGATCGTGTCTGG + Intronic
1118105236 14:62651189-62651211 ATTTCACTGCTCAGGGTGGCTGG + Intergenic
1122005943 14:98703689-98703711 CTTTCTCTGATGATCATGGCTGG - Intergenic
1122043519 14:99007367-99007389 TTTTCTCTGTTGATCTTGGCTGG - Intergenic
1122102787 14:99426793-99426815 CTTGCTTTTCTGAGCTTGGCAGG - Intronic
1123057273 14:105577394-105577416 CTGTCTGTGCTGACCGGGGCAGG - Intergenic
1125629487 15:41135458-41135480 CTTTCCCTGCTGATCATGTCCGG + Intergenic
1125719112 15:41836671-41836693 CTTTCACTGCTGAGCCAAGCAGG + Intronic
1126529956 15:49701390-49701412 CTCTCCCTGCTGATCGTGTCTGG - Intergenic
1129057939 15:72835512-72835534 CTTTCTCTTCTTAGGGGGGCAGG - Intergenic
1129732078 15:77938393-77938415 CTCTCTCAGCTGAGCAGGGCAGG + Intergenic
1130349526 15:83078856-83078878 GGCTCTGTGCTGAGCGTGGCAGG - Intergenic
1130648790 15:85750598-85750620 CTTGCCCTGCTGAGGGTGTCTGG - Intergenic
1133707059 16:8364773-8364795 GTTTCTCAGCTGATCATGGCTGG + Intergenic
1136556927 16:31012383-31012405 CTTTCTGTGCTTTGAGTGGCTGG - Intergenic
1136618834 16:31414670-31414692 CGTTCTCTGCTGAGCGAGGTGGG + Intronic
1138647594 16:58436417-58436439 TTTTCTAAGTTGAGCGTGGCGGG + Intergenic
1142057086 16:88004742-88004764 CTGTCTGTGCAGAGCGTGTCAGG + Intronic
1145243104 17:21251117-21251139 CTTTCTCCCCTGGGCTTGGCTGG + Intronic
1147420300 17:40319087-40319109 TTTGCTCTGCTGAGGGTGTCTGG + Intronic
1149654282 17:58302194-58302216 CTGTCTCTGCTGAGCAGGGAAGG - Intronic
1152873632 17:82772955-82772977 TTTTCTCTGCTGAGCGCAGCAGG + Intronic
1156735629 18:40255193-40255215 CTTTCACAGCTGAGTGTGGTTGG + Intergenic
1158576597 18:58643892-58643914 CTCTCCCTGCTGATCGTGTCTGG - Intergenic
1161587283 19:5112525-5112547 CTGTTTCTGCAGAGCGTGGTGGG - Intronic
1162262438 19:9543863-9543885 CTTTCCCTGCTGATCATGTCTGG + Intergenic
1163722679 19:18905748-18905770 CCTCCTCTGCTGGGCGGGGCTGG - Intronic
1164418002 19:28062301-28062323 CTGGCTCTCATGAGCGTGGCTGG + Intergenic
1165150162 19:33755555-33755577 CTTTCACGCCTGCGCGTGGCAGG - Intronic
1166726480 19:45031434-45031456 TTTTCTCTGCTGACTGTGCCTGG + Intronic
1166890249 19:45987389-45987411 CTGCATCTGCTGAACGTGGCCGG + Intergenic
929684331 2:44021286-44021308 CTCTCTCTGCTGATTGTGTCCGG - Intergenic
931718135 2:65045755-65045777 CTTTCTCTGCGGGGGGTGGGGGG - Intergenic
933898840 2:86835086-86835108 CTTTCTGTGCTGGGTGGGGCTGG + Intronic
934544569 2:95204114-95204136 CTTCCTGTGCTGTGAGTGGCAGG + Intergenic
938038094 2:128053266-128053288 CTGTCTCTGCTGAGCCATGCAGG + Intergenic
938725251 2:134103136-134103158 CTGTCTCTGCTGGGGGAGGCAGG - Intergenic
939996647 2:148926397-148926419 TTCTGTCTGCGGAGCGTGGCTGG + Intronic
942153902 2:173107226-173107248 CTTGCTCTGCAGAGCTTGGTGGG - Intronic
944561280 2:200940967-200940989 CTTTTTCTGCTGTGTGTAGCTGG - Intronic
945361828 2:208902687-208902709 CTCTCCCTGCTGATCGTGTCTGG + Intergenic
947610169 2:231520203-231520225 CTTTTTCTGCTGAAGTTGGCTGG - Intergenic
947659517 2:231856086-231856108 CTCTCATTGCTGAGTGTGGCAGG - Intergenic
948573992 2:238938094-238938116 CTGCCTCTGCGGAGCTTGGCTGG + Intergenic
1168734286 20:116507-116529 CCAGCTCTGATGAGCGTGGCTGG - Intergenic
1170126076 20:12965624-12965646 CTTTCTCTGGTGAGCAAGCCTGG - Intergenic
1170906367 20:20518349-20518371 CTATCTCTGGTCAGGGTGGCCGG - Intronic
1175136564 20:56828713-56828735 CTGTCTCAGCTGTGCTTGGCTGG - Intergenic
1177102864 21:16917451-16917473 CTCTCTCTCCTGATCGTGTCTGG + Intergenic
1179510139 21:41867114-41867136 CTTTCTGGGCTGAGGGTGTCGGG - Intronic
1180199018 21:46213724-46213746 CTATCTCTGGTGAGTGTGGCTGG - Exonic
1181375340 22:22453681-22453703 CTTTCCCTGCTGAGTGTGCGTGG - Intergenic
1182567450 22:31210953-31210975 TTTTCTCTTCTGGGTGTGGCAGG - Intergenic
1182998795 22:34837773-34837795 CTCTCCCTGCTGATCGTGTCTGG + Intergenic
1183467491 22:37986977-37986999 CTTTCCCTGCTGGGGGTGGCAGG + Intronic
1183690286 22:39384336-39384358 CTTTCCCTGCCTAGGGTGGCAGG - Exonic
1184256570 22:43290438-43290460 CTTTGCCTGCTGGGCTTGGCTGG + Intronic
1184294989 22:43517442-43517464 GGTGCTCTGCTGAGCCTGGCTGG + Intergenic
1184441971 22:44522686-44522708 GGTGCTCTGCTGAGCCTGGCAGG - Intergenic
1184894886 22:47401103-47401125 CACTATCTGCTGAGCGTGGCTGG + Intergenic
949761055 3:7471433-7471455 GTTTCTCTGCTGACAGTGGTGGG + Intronic
950808597 3:15629889-15629911 CTTTCTCTGCTTTGTGTGGCAGG + Intronic
953240369 3:41143341-41143363 CCTTCTCTGATGAGCAAGGCTGG - Intergenic
953599215 3:44347114-44347136 CTCTCCCTGCTGATCGTGTCTGG - Intronic
955378869 3:58421134-58421156 GGTTCTCTCCTGAGGGTGGCTGG + Intronic
955981410 3:64531253-64531275 CTTTCTCAGGTGAGGGAGGCAGG + Intronic
956548803 3:70437113-70437135 CTCTCCCTGCTGATCGTGTCTGG - Intergenic
957304898 3:78444438-78444460 CTTTCTCTGCTGCCCCAGGCTGG - Intergenic
957420458 3:79961472-79961494 CTTTCTCAGCCTAGAGTGGCTGG - Intergenic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
961457827 3:127033006-127033028 CCTTCTCTGCTCGGCCTGGCAGG - Intronic
962242623 3:133764013-133764035 TTTTCTCTGCTGAGTGTGCCTGG + Intronic
962281368 3:134054428-134054450 CTTACTCTGCTCTGCCTGGCTGG - Intergenic
963861156 3:150312001-150312023 TTTTCTCTTCTGATTGTGGCAGG + Intergenic
964627017 3:158769407-158769429 GTTTCTCTGATGAGAATGGCTGG - Intronic
964743092 3:159988059-159988081 CTTTCTGTGCTGAGAGTAGTGGG - Intergenic
964940767 3:162156386-162156408 CTTTCCCTGCTGAGTGTGTCTGG - Intergenic
967097440 3:186188509-186188531 ATTTCTCTTCTGACAGTGGCAGG - Intronic
968509562 4:989431-989453 CTCTCGCTGCTCAGCCTGGCCGG - Exonic
968922549 4:3530176-3530198 CTCTTTCTGCCGAGCGTGCCAGG - Intronic
969046688 4:4341516-4341538 CTGTCTCTCCGGAGCATGGCTGG - Intergenic
969146254 4:5126394-5126416 CCAGCCCTGCTGAGCGTGGCTGG + Intronic
969272351 4:6111357-6111379 CTTTCTGTGCTCAGCCTGGCTGG + Intronic
974785024 4:66609108-66609130 CTTTCTCTGATGGAGGTGGCTGG + Intergenic
976149643 4:82079087-82079109 CTTGCTCTGCTGCCTGTGGCTGG - Intergenic
976335056 4:83876038-83876060 CTTCCTCTGATGAGAGAGGCAGG + Intergenic
980111725 4:128643117-128643139 CTCTCCCTGCTGATCGTGTCCGG - Intergenic
981921614 4:150090891-150090913 CTATTTCTGCAGAGCGGGGCTGG - Intronic
982396538 4:154921094-154921116 CTCTCCCTGCTGATCGTGTCCGG - Intergenic
982758288 4:159250866-159250888 CTCTCTGGGCTGGGCGTGGCCGG + Intronic
983024071 4:162712558-162712580 CTTTCCCTGATGATCGTGTCCGG + Intergenic
983345746 4:166523984-166524006 CTCTCCCTGCTGATCGTGTCTGG + Intergenic
984639067 4:182143660-182143682 CCTTTTCTGCTGCGGGTGGCGGG - Intergenic
984714585 4:182914672-182914694 CTGCCTGTGCTGAGCCTGGCAGG - Intronic
985394788 4:189530818-189530840 CTCACTCTGATGAGGGTGGCGGG + Intergenic
985912717 5:2896212-2896234 CTCTCTCTGCTGAGTGGGGCTGG + Intergenic
987728231 5:21731563-21731585 CCTTCTCTGCTGTGCTTGTCAGG + Intergenic
990338553 5:54800211-54800233 CTTTCTCTGCTGATCATGTTGGG - Intergenic
994295330 5:98082525-98082547 CTCTCCCTGCTGATCGTGTCCGG + Intergenic
994942205 5:106339353-106339375 TTGTCTCTGCTGATCGTGCCTGG + Intergenic
995326455 5:110894403-110894425 CTTTCTCTGCTGGCCAAGGCCGG - Intergenic
996052418 5:118948980-118949002 CTCTCCCTGCTGATCGTGTCTGG - Intronic
996358429 5:122621120-122621142 CTCTCTCTGCTGATCATGTCCGG - Intergenic
996510085 5:124307246-124307268 CTCTCCCTGCTGATCGTGTCCGG + Intergenic
997698700 5:135881169-135881191 CTTTGTCTTCTGAGCTTTGCAGG - Intronic
999122913 5:149223710-149223732 ACTTCTCTGCTGAGCTTAGCGGG - Intronic
999149308 5:149416240-149416262 CTTCCTGTGCTGAGCTGGGCAGG - Intergenic
1002875057 6:1203062-1203084 CTTTCTCCGCTGAGCCTTCCCGG + Intergenic
1003673082 6:8177999-8178021 CCTTCACTGCTCAGCCTGGCAGG + Intergenic
1007419014 6:41708129-41708151 CTTCCTCTGCTGTGAGTGCCTGG + Intronic
1007708821 6:43808067-43808089 CTTTCTCCTCTGAGGCTGGCTGG + Intergenic
1009312245 6:62169892-62169914 CTTTGTCTGGTGAGGGTGGATGG - Intronic
1011817776 6:91213206-91213228 CCTGCTCTGCTGAAGGTGGCAGG + Intergenic
1015765044 6:136707351-136707373 CCTTCTCTGCTGAGCTTCCCAGG - Intronic
1019647603 7:2139402-2139424 CCTTCACTGCTGAGGGTGGGGGG - Intronic
1022447599 7:30482690-30482712 CTCTCTCTGCTGATCCTGACTGG + Intergenic
1022502663 7:30892440-30892462 CTGTCTGTGCTGATCATGGCTGG + Intergenic
1023881181 7:44322629-44322651 CCTTCCCTGCTCAGCCTGGCAGG - Intronic
1026866765 7:73828902-73828924 CTTGCTCTGTTGCCCGTGGCTGG + Exonic
1029280670 7:99433459-99433481 CTCTCTCTGCTGAGGGTCTCTGG - Intronic
1029369115 7:100136527-100136549 CTTTCTGGGCTGGGCGTGGTGGG - Intergenic
1030163422 7:106530684-106530706 CTCTCCCTGCTGATCGTGTCCGG - Intergenic
1031704413 7:124962886-124962908 CTCTCCCTGCTGATCGTGTCCGG - Intergenic
1034084628 7:148312302-148312324 CTTTCCCTGCTGATCGTGTCTGG - Intronic
1035568500 8:657891-657913 CTTCCTCTTCTGGGAGTGGCTGG - Intronic
1035872454 8:3150437-3150459 CTTGCTCAGCAGAGAGTGGCCGG - Intronic
1038358147 8:26849369-26849391 CTTTGTCTGCTGACCTTGCCTGG - Intronic
1041917341 8:63150573-63150595 CTTTCCCTGCTGATCGTATCTGG - Intergenic
1043008856 8:74856712-74856734 CTTTCTATGCTGAGAGCAGCAGG - Intergenic
1043391284 8:79794736-79794758 CTTTCTGTACTGAGGCTGGCTGG - Intergenic
1045245466 8:100438340-100438362 TTTTCTCTGCTGAGTATGACTGG - Intergenic
1046604182 8:116352362-116352384 CTTCCTCTGCTGAGAGGGGACGG - Intergenic
1048080542 8:131121870-131121892 CTGCCTCTGCTGAGAGAGGCTGG - Intergenic
1049352904 8:142173563-142173585 CTTTCTCTGCTGTCCGGGGCTGG - Intergenic
1049405197 8:142449273-142449295 GCTTCTCTGCTGCGCGGGGCAGG + Intergenic
1050896270 9:10888230-10888252 CTCTCCCTGCTGATCGTGTCCGG + Intergenic
1052801609 9:32973274-32973296 TATTCTCTGGTGAGGGTGGCTGG - Exonic
1053476398 9:38385056-38385078 GTTTCTCTCCTCAGTGTGGCTGG - Intergenic
1056627054 9:88262564-88262586 CTTTCTGTGCTGAGAGCAGCAGG - Intergenic
1059299471 9:113300588-113300610 CTTCCTCCACTGTGCGTGGCTGG - Intronic
1059911491 9:119049390-119049412 CTTTCTTTGCTGAGTGTCCCAGG - Intergenic
1060803774 9:126562288-126562310 CTTTCTCTGCAGTGCATTGCTGG - Intergenic
1061974194 9:134060115-134060137 CTGTCTCTGCTGGGCCCGGCAGG - Intronic
1062009025 9:134257204-134257226 CTCTCTCTGCTGGGAGTGTCTGG + Intergenic
1062457208 9:136645428-136645450 CTTTTTCTGTTGGCCGTGGCTGG - Intergenic
1186344261 X:8675333-8675355 CTTTCTCTGCTGAGCGTGGCAGG - Intronic
1186556026 X:10559717-10559739 CTTTCTCTGTTGATGGTGGCAGG - Intronic
1187399368 X:18946275-18946297 ACTTCCCTGCTGAGCGTGCCTGG + Intronic
1188332820 X:28894869-28894891 CTCTCCCTGCTGATCGTGTCCGG - Intronic
1190151527 X:47954052-47954074 CTCTCTCTGCAGATGGTGGCAGG + Intronic
1190259574 X:48789644-48789666 CTTCCTCTGAAGAGGGTGGCAGG - Intronic
1191080635 X:56506017-56506039 CTTTCTCTGCTGAGTCATGCAGG - Intergenic
1192731304 X:73804989-73805011 CTCTCCCTGCTGATCGTGTCTGG - Intergenic
1195290963 X:103431785-103431807 CTCTCCCTGCTGATCGTGTCTGG - Intergenic
1197024137 X:121727092-121727114 CTTTCTCTCTTGAGCAAGGCAGG - Intergenic
1197572105 X:128162862-128162884 CTGTCTCTGGTGAAAGTGGCAGG + Intergenic
1197607736 X:128605120-128605142 GTTTCTTTGCTAAGTGTGGCTGG + Intergenic
1199004368 X:142677625-142677647 CTTTCTCTGCTGTGTATGGAAGG - Intergenic
1201147282 Y:11072231-11072253 CTTTCTCTCCTCTGCCTGGCTGG - Intergenic