ID: 1186346382

View in Genome Browser
Species Human (GRCh38)
Location X:8697309-8697331
Sequence AGCCCTATTCTGATTCTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 130}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186346382_1186346386 24 Left 1186346382 X:8697309-8697331 CCAGTGAGAATCAGAATAGGGCT 0: 1
1: 0
2: 1
3: 5
4: 130
Right 1186346386 X:8697356-8697378 GAAATGAATCATTAGGTTTAAGG 0: 1
1: 0
2: 1
3: 30
4: 321
1186346382_1186346384 2 Left 1186346382 X:8697309-8697331 CCAGTGAGAATCAGAATAGGGCT 0: 1
1: 0
2: 1
3: 5
4: 130
Right 1186346384 X:8697334-8697356 GGATTTTAGTCTGAGTGAGACGG 0: 1
1: 7
2: 53
3: 212
4: 822
1186346382_1186346385 17 Left 1186346382 X:8697309-8697331 CCAGTGAGAATCAGAATAGGGCT 0: 1
1: 0
2: 1
3: 5
4: 130
Right 1186346385 X:8697349-8697371 TGAGACGGAAATGAATCATTAGG 0: 1
1: 0
2: 0
3: 22
4: 656

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186346382 Original CRISPR AGCCCTATTCTGATTCTCAC TGG (reversed) Intronic
901829469 1:11883297-11883319 ACCCCTATCCTGAATCTCCCAGG - Intergenic
906096108 1:43225106-43225128 AGCTCTGTTCAGATTCTCAAAGG + Intronic
907474646 1:54697734-54697756 AGGCCTGTTCTGAATCTCTCTGG - Intronic
908390255 1:63677559-63677581 TGCCCTATGCTGAGTCTCATGGG - Intergenic
909331688 1:74420436-74420458 AGCCCTGTTCTCATCCTCAAAGG - Intronic
909354426 1:74691305-74691327 TGCCCTTGTCTGATTCTCAATGG - Intergenic
909466953 1:75983200-75983222 AGACCTATTCTGTTTCTTGCTGG + Intergenic
910260934 1:85293088-85293110 AGCTCTATACTATTTCTCACAGG - Intergenic
912493532 1:110076455-110076477 AGCCATATTTTGACTCTTACAGG + Intergenic
912626337 1:111207531-111207553 AGACCAATTCTGATATTCACTGG + Intronic
913045021 1:115066904-115066926 AGCACTATCCTGACTCTCAAAGG - Intronic
913573887 1:120149939-120149961 TGTCTTATTCTGGTTCTCACAGG + Intergenic
914295145 1:146314739-146314761 TGTCTTATTCTGGTTCTCACAGG + Intergenic
914556186 1:148765522-148765544 TGTCTTATTCTGGTTCTCACAGG + Intergenic
914616647 1:149364711-149364733 TGTCTTATTCTGGTTCTCACAGG - Intergenic
916300970 1:163274211-163274233 AGCCCTATTCTGAGGCTATCTGG - Intronic
917949836 1:180020116-180020138 AGCCATATTATGATTCTTCCTGG - Exonic
920044342 1:203123853-203123875 AAACATGTTCTGATTCTCACTGG + Intronic
920544548 1:206804604-206804626 ACCCCAAATCTCATTCTCACTGG - Intronic
1064606006 10:17039470-17039492 AGGACTATTCTGATTCCCACTGG - Intronic
1067658089 10:48212363-48212385 AAGGCTTTTCTGATTCTCACAGG + Intronic
1069204862 10:65668719-65668741 AAACCTCTTCTGATCCTCACTGG + Intergenic
1073347861 10:102798174-102798196 AGCCCTTTTCGGATTCTCTTGGG + Intronic
1074014044 10:109515104-109515126 ACCCCTTTTCTGATTCTCCCAGG - Intergenic
1074687076 10:115971293-115971315 AGCCCCATCATGATGCTCACAGG - Intergenic
1079290518 11:19184246-19184268 AGGCCTATTCTGTTGCTCAGTGG - Intronic
1081299336 11:41431414-41431436 AGCCATATTCTGAGCCTGACTGG + Intronic
1087196378 11:95308176-95308198 TGCCCTATTCAGACTCTCAATGG - Intergenic
1094509156 12:31085688-31085710 AGCCCTGTTCCCATTCACACTGG + Intronic
1095740015 12:45596730-45596752 AGCCCTAATCAGATTCTCTGAGG + Intergenic
1096045412 12:48558107-48558129 AGGCCTGTTCTGATTCTGAACGG - Intergenic
1098775443 12:74608652-74608674 AGAACTCTGCTGATTCTCACTGG - Intergenic
1100378303 12:94038192-94038214 AGCCCTATCTTGTTTCTCAAAGG + Intergenic
1101711973 12:107275966-107275988 AGCCTAATTCTGATTCTGTCTGG - Intergenic
1102482758 12:113235089-113235111 TGACCTGTTCTGATTCCCACTGG - Intronic
1102807219 12:115792708-115792730 AGCCCAGAGCTGATTCTCACTGG + Intergenic
1107230802 13:38107840-38107862 AGACATATTCTGGTTCTCAAGGG - Intergenic
1114482631 14:23045131-23045153 AGCCCTATCCTGAGCCTCTCAGG + Intergenic
1118423784 14:65635405-65635427 TGTCTTATTCTAATTCTCACAGG + Intronic
1120841367 14:89088169-89088191 AAGCCTTTTCTGATTCTCCCAGG - Intergenic
1129903780 15:79171953-79171975 AGCCCTCTTCTGATTCTGCAAGG - Intergenic
1134066322 16:11230757-11230779 AGCCCTATTCTGATCCTTCTTGG + Intergenic
1136555532 16:31005644-31005666 GGTCATATTCTTATTCTCACTGG + Intronic
1138562298 16:57808812-57808834 AGCCCTACTCTCATTTTCACAGG - Intronic
1139062424 16:63269335-63269357 AACCCTATTGTGATTTTCATTGG + Intergenic
1141679769 16:85537283-85537305 ATCCTGATTTTGATTCTCACAGG + Intergenic
1142517728 17:443608-443630 GACCCTATGCTGCTTCTCACTGG - Intronic
1150366407 17:64589954-64589976 AGCCCTATTGTGGTTATCCCAGG - Intronic
1150489802 17:65566456-65566478 AGCCCTGTTGTGATTCTTTCAGG - Intronic
1154000060 18:10475085-10475107 GGCCCTATCCTGATGCCCACAGG - Intronic
1157557925 18:48624911-48624933 AGCCCTATTTTGATGCTTTCCGG + Intronic
1158238216 18:55344404-55344426 AGCCCTGTTATAATTCTCTCTGG + Intronic
1158326475 18:56318803-56318825 GGTCCTATTCTGATTTTTACTGG - Intergenic
1158632802 18:59131027-59131049 AGCCCAAATCTGATTCACAGTGG - Intergenic
1160764502 19:801433-801455 AGCCCTAATCTCATTCCCATGGG - Intronic
1165389285 19:35529217-35529239 AGCCCGAGTCTGGGTCTCACAGG + Intergenic
926617233 2:15009001-15009023 AGGCTGATTCTGATTGTCACTGG - Intergenic
932690998 2:73913654-73913676 GCCCCTTTTCTGATTCTGACTGG + Intronic
933836696 2:86251604-86251626 TGCCCTCTTCTGTTTCTCCCAGG + Intronic
937774159 2:125755980-125756002 ATACCTATTCTGATTATAACAGG + Intergenic
938560611 2:132469197-132469219 AGCCCTTTTCTGATGCCTACAGG - Intronic
938722513 2:134079105-134079127 AGCCCAATTCTGTATCTCATGGG + Intergenic
942258127 2:174127898-174127920 ATCCCTATTATGATTTTAACTGG - Intronic
942431644 2:175917940-175917962 AGCCCTCATCTGATTTTCAGAGG - Intergenic
943270210 2:185791533-185791555 AGCCATTTTCTGATTCTTATTGG - Exonic
943799045 2:192034848-192034870 TGCCCTATCCTGCTTTTCACTGG + Intronic
944360593 2:198851020-198851042 AGACATTTTCTGATTATCACTGG - Intergenic
945546508 2:211159616-211159638 AGCCCATATCTGAATCTCACTGG + Intergenic
946773338 2:223111933-223111955 AGCCCAACTCTGATCCTGACAGG - Intronic
946841707 2:223826182-223826204 AGGACTAGTCTGATTCTCAAAGG - Intronic
1170261874 20:14418154-14418176 AGTCCTATTCTGTTCATCACAGG - Intronic
1174913069 20:54627506-54627528 AGCCCTGGACTGATACTCACTGG + Intronic
1175075190 20:56366192-56366214 AGCGTAATGCTGATTCTCACTGG - Exonic
1175635032 20:60574748-60574770 GGCCCTATTCCAATTATCACTGG + Intergenic
1177706589 21:24714075-24714097 AACCCTTTTCTGTTTCCCACAGG - Intergenic
955548075 3:60053054-60053076 ATTCTTATTCTCATTCTCACTGG - Intronic
955905986 3:63808073-63808095 ATCCTAATTCTGAGTCTCACTGG + Intergenic
956664068 3:71625713-71625735 CACCATATTCTCATTCTCACTGG - Intergenic
959382368 3:105656663-105656685 AGTCCTTTTTTAATTCTCACTGG + Exonic
959622020 3:108408966-108408988 TGCCCTATTCTGTTTGTCAAAGG - Intronic
965592460 3:170375213-170375235 AGCTCTAGTCTGACTCTTACTGG + Intronic
966545149 3:181138041-181138063 AGTCCCATCCTAATTCTCACTGG - Intergenic
966745027 3:183267289-183267311 TGCCCTATACTGATTATCTCTGG + Intronic
969642330 4:8406322-8406344 ACTCCTCTTCTGATTCTCATAGG - Intronic
970974544 4:22028417-22028439 AGCCTTATCTTCATTCTCACTGG + Intergenic
971419781 4:26464834-26464856 AGCCTGTTTCTGCTTCTCACAGG - Intergenic
971505089 4:27357987-27358009 AGACCTACTCTGTTTCTCACTGG - Intergenic
971971240 4:33623300-33623322 AGGCCTCTTCTGATTTTCTCTGG - Intergenic
972475659 4:39446978-39447000 ACCCCTATGCTGACTCGCACTGG + Exonic
975986735 4:80207296-80207318 AGCCCTTTTCTGAGTGTGACTGG - Intergenic
977419782 4:96784503-96784525 AGGCCTATGCTGAGTCTCAGGGG + Intergenic
979887300 4:126045300-126045322 TGCTCTATTCAGATTCTCAGGGG - Intergenic
980847851 4:138345337-138345359 ACCCTTATTCTGCTTATCACAGG - Intergenic
984465729 4:180098728-180098750 TGCCTTATTCTGGTTCTCAAGGG + Intergenic
984832872 4:183991916-183991938 AGCCCAGTTCTGCTCCTCACTGG - Intronic
988242633 5:28633405-28633427 AGCAATATGCTGATTCTCATGGG - Intergenic
990790685 5:59475304-59475326 AGCTTTATTCAGATTCTCAAAGG + Intronic
992360245 5:76030643-76030665 AGCCGTATTCTGTCTCTCTCAGG + Intergenic
992987917 5:82252540-82252562 GGACCAATTCTGATTCTTACAGG + Exonic
996000431 5:118355366-118355388 ATTCCTATTCTCATTGTCACTGG + Intergenic
997227189 5:132217872-132217894 ATCCCTCATCTGTTTCTCACTGG - Intronic
998758058 5:145402563-145402585 ATCCCTTTTCCAATTCTCACTGG + Intergenic
1001858423 5:175032703-175032725 TGCCCTATTCTGATTCACACTGG + Intergenic
1001861336 5:175058277-175058299 ACCCCTACTCTGATGCTTACTGG + Intergenic
1003053163 6:2797792-2797814 AGCCCCAATTTGAATCTCACAGG + Intergenic
1003123421 6:3336500-3336522 AGGCCTATTCCCCTTCTCACAGG + Intronic
1004468327 6:15906274-15906296 AGCCCTACCCCGATTCTTACTGG + Intergenic
1006453409 6:34118449-34118471 AGCCCAGCTCTGATTCTAACTGG + Intronic
1011044477 6:83066580-83066602 AGCCCTATTGTAATTCTACCCGG - Intergenic
1011640080 6:89410350-89410372 ATCCCTATTCTGCATCTCTCCGG + Intronic
1011953047 6:92991360-92991382 ATCCCTTTTCTAATTCTCTCAGG + Intergenic
1017021089 6:150141322-150141344 ATCCCTATTCAGGCTCTCACTGG + Intergenic
1018082987 6:160274813-160274835 GTCCAAATTCTGATTCTCACTGG - Intronic
1020245170 7:6424051-6424073 AGCCCTCTTCTGCTCCTGACTGG - Intronic
1022611672 7:31881316-31881338 AGCCCTCTTGTGGTTCTCAGTGG - Intronic
1022866916 7:34431239-34431261 TTCCCTATTCTGATTCTTAATGG - Intergenic
1022975027 7:35548885-35548907 AGCCATACTCTGCTTCTCCCTGG + Intergenic
1023519026 7:41032386-41032408 AGCAATCTTCTGCTTCTCACTGG - Intergenic
1023579605 7:41667414-41667436 AGCCCTAATCTGAAGCTCACTGG - Intergenic
1027856194 7:83514702-83514724 ATCCCTATTCTTATTCTAAAGGG + Intronic
1029231764 7:99075600-99075622 ATCCCAATTCTGATGCTAACTGG - Intronic
1030599709 7:111579878-111579900 TGCCCTACTCAGATTTTCACAGG + Intergenic
1032444395 7:131969279-131969301 ATGCCTCTTCTGATTATCACAGG - Intergenic
1032516874 7:132512913-132512935 AGCCCAACTCTGATTCTTAAAGG + Intronic
1032665073 7:134028010-134028032 AGCCTTATTCACATTCTCCCTGG + Intronic
1034172959 7:149077232-149077254 AGCTCTATTGGGATTCTGACTGG + Intronic
1035241292 7:157531370-157531392 AGCCCAATTCTCAGTCTCAGTGG - Intergenic
1042331121 8:67581732-67581754 AGTCCTATTCTGAATCTTAGTGG - Intronic
1043301135 8:78734459-78734481 TGCACTATTCCCATTCTCACAGG - Intronic
1049919711 9:351910-351932 AGACAAATCCTGATTCTCACAGG - Intronic
1052996672 9:34554874-34554896 AGCCCCATTCTGTGACTCACTGG - Intronic
1059656972 9:116366146-116366168 AGGCCTAGTCAGATTCTGACAGG + Intronic
1059891060 9:118804913-118804935 TGTCTTATTCTGATTCTCAAAGG - Intergenic
1061212825 9:129203457-129203479 AGGCCTAGTCTGAATGTCACCGG - Intergenic
1186346382 X:8697309-8697331 AGCCCTATTCTGATTCTCACTGG - Intronic
1199547869 X:149026814-149026836 AGCAATATTCAGTTTCTCACCGG + Intergenic
1201973533 Y:19820762-19820784 AGACGTATTCTGAATTTCACTGG - Intergenic