ID: 1186349315

View in Genome Browser
Species Human (GRCh38)
Location X:8727328-8727350
Sequence TGCAGGGACCATAGTGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 207}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186349315_1186349331 9 Left 1186349315 X:8727328-8727350 CCCTGCCCACTATGGTCCCTGCA 0: 1
1: 0
2: 0
3: 27
4: 207
Right 1186349331 X:8727360-8727382 CATGGGTGTAGGGAAGATCAGGG 0: 1
1: 0
2: 1
3: 9
4: 195
1186349315_1186349324 -8 Left 1186349315 X:8727328-8727350 CCCTGCCCACTATGGTCCCTGCA 0: 1
1: 0
2: 0
3: 27
4: 207
Right 1186349324 X:8727343-8727365 TCCCTGCAGGGACCGGGCATGGG 0: 1
1: 0
2: 5
3: 11
4: 186
1186349315_1186349332 13 Left 1186349315 X:8727328-8727350 CCCTGCCCACTATGGTCCCTGCA 0: 1
1: 0
2: 0
3: 27
4: 207
Right 1186349332 X:8727364-8727386 GGTGTAGGGAAGATCAGGGTTGG 0: 1
1: 0
2: 0
3: 20
4: 262
1186349315_1186349327 -2 Left 1186349315 X:8727328-8727350 CCCTGCCCACTATGGTCCCTGCA 0: 1
1: 0
2: 0
3: 27
4: 207
Right 1186349327 X:8727349-8727371 CAGGGACCGGGCATGGGTGTAGG 0: 1
1: 0
2: 2
3: 26
4: 260
1186349315_1186349330 8 Left 1186349315 X:8727328-8727350 CCCTGCCCACTATGGTCCCTGCA 0: 1
1: 0
2: 0
3: 27
4: 207
Right 1186349330 X:8727359-8727381 GCATGGGTGTAGGGAAGATCAGG 0: 1
1: 0
2: 0
3: 18
4: 149
1186349315_1186349323 -9 Left 1186349315 X:8727328-8727350 CCCTGCCCACTATGGTCCCTGCA 0: 1
1: 0
2: 0
3: 27
4: 207
Right 1186349323 X:8727342-8727364 GTCCCTGCAGGGACCGGGCATGG 0: 1
1: 0
2: 2
3: 28
4: 377
1186349315_1186349328 -1 Left 1186349315 X:8727328-8727350 CCCTGCCCACTATGGTCCCTGCA 0: 1
1: 0
2: 0
3: 27
4: 207
Right 1186349328 X:8727350-8727372 AGGGACCGGGCATGGGTGTAGGG 0: 1
1: 0
2: 2
3: 16
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186349315 Original CRISPR TGCAGGGACCATAGTGGGCA GGG (reversed) Intronic
901017113 1:6238197-6238219 TGCAGGGACAAGAGTGGAGAGGG - Intergenic
901318420 1:8324319-8324341 TGCGGGGATCATCGTGGGGAGGG - Exonic
901798291 1:11692692-11692714 TGGAGGGAGCATATAGGGCAGGG - Intronic
902490297 1:16776362-16776384 TCCTGAGACCATAGTGGGCAGGG - Intronic
903179972 1:21600294-21600316 TGCAGGAGCCAGAGTGGGGAGGG - Intronic
903657753 1:24959447-24959469 GGCAAGCGCCATAGTGGGCACGG + Intronic
906263012 1:44407333-44407355 TGGGGGGAGCAGAGTGGGCAGGG + Intronic
906553406 1:46686557-46686579 TGGGGGGACCATAGTGAGCAAGG - Intronic
907668898 1:56457552-56457574 TGGAGGGATTATAATGGGCAAGG - Intergenic
908332539 1:63084845-63084867 AGCAGTGACCAAGGTGGGCATGG - Intergenic
909386904 1:75068169-75068191 TGCATCCACCACAGTGGGCAGGG + Intergenic
910111026 1:83683497-83683519 TGCAGGGACAAAAGTGAGCCAGG - Intergenic
911426388 1:97719239-97719261 TGGAGGGACCATAGTGGAAAAGG - Intronic
914917317 1:151826556-151826578 TGCAGGGAGGAGCGTGGGCATGG - Intronic
915246964 1:154562776-154562798 TGCAGGAATTCTAGTGGGCACGG - Intergenic
916225967 1:162489903-162489925 TGTTGGGACCAGAGTGGACATGG + Intergenic
919744250 1:200999014-200999036 TGCATGGACCACACTGGGGAAGG + Intronic
921219535 1:212963328-212963350 TGCAGTGGCCCCAGTGGGCAGGG - Intronic
921329463 1:214021085-214021107 TGCAGGGAGCATATTGGGAGAGG + Intronic
921785256 1:219221940-219221962 GGCAGAGATCATAGTGGGGAAGG - Intergenic
922072066 1:222204401-222204423 TTAAGGTAGCATAGTGGGCAGGG + Intergenic
923274430 1:232384225-232384247 CACAGGGAGCATAGTGGACAAGG - Intergenic
923530143 1:234806168-234806190 TCCTGAGACCATAGTGGGCAGGG + Intergenic
1063076099 10:2718408-2718430 AGCTGGGAGCATGGTGGGCAGGG - Intergenic
1066442243 10:35449722-35449744 TGCAGGGAGCAGAGATGGCAGGG + Intronic
1066488780 10:35874069-35874091 TGCAGGGTCCAGGCTGGGCATGG - Intergenic
1069795119 10:71046946-71046968 TGCATGGAACTTAGCGGGCAGGG + Intergenic
1070722789 10:78768270-78768292 TGAAGGGACCACACTGGGCAGGG - Intergenic
1072153514 10:92702536-92702558 AGCAGAAAGCATAGTGGGCAGGG + Intergenic
1075021816 10:118957651-118957673 TGCAGGGTTCAGAGGGGGCACGG + Intergenic
1076003394 10:126929704-126929726 TGGAGGGACCATTGCGGGGAGGG + Intronic
1081855327 11:46299825-46299847 TGCAGGGACAGTGGTGGCCATGG + Intronic
1082786006 11:57317109-57317131 TGCAGGGACGAGTGTGGTCAGGG - Intronic
1082812556 11:57487287-57487309 AGCGGGGACCATGGTGGGGAGGG - Intronic
1083307963 11:61770568-61770590 TACAGGGACCAGGGTGGGCAGGG + Intronic
1083831779 11:65238197-65238219 TGCAGGGAATAAAGTGGACAGGG - Intergenic
1084460709 11:69295108-69295130 TGAAGGGACCCTAGAGGCCATGG + Intronic
1085130895 11:74037561-74037583 TGTAGGGACCATCTTGGGCCAGG - Exonic
1085409189 11:76281587-76281609 TGCAGGGGCCATGGTGGGCGAGG + Intergenic
1085442935 11:76579678-76579700 TGCAGGGACCATACATGGAAGGG + Intergenic
1085524878 11:77158264-77158286 TGCAGTTACCCTGGTGGGCAGGG - Exonic
1089218738 11:116852973-116852995 TGGAGGGTGCAGAGTGGGCAAGG + Intronic
1089572746 11:119421042-119421064 TGCAGGGACGAGAGGGGGAATGG - Intronic
1090433483 11:126666317-126666339 TGCAGGGATAAGAGTGAGCATGG + Intronic
1091873777 12:3916976-3916998 TGATGGGACCAGAGTGGGCCTGG - Intergenic
1094156126 12:27338500-27338522 TCCAGGGAACAGAGTAGGCATGG + Intronic
1094342653 12:29430394-29430416 TGCAGTGACCAAGGTGGGTAGGG + Intronic
1094343586 12:29440995-29441017 TTCATAGACCATAGTGTGCATGG + Intronic
1096498293 12:52051115-52051137 TGCGGGGAGCCTAGTGGGCCTGG + Intronic
1098154579 12:67584260-67584282 TGTATGGACCATAGTAGGCTTGG - Intergenic
1098290201 12:68950902-68950924 TGCAGGGAAGGTAGTTGGCAAGG - Intronic
1099345301 12:81492393-81492415 TGCAGGGATGATAGTGGGGTTGG + Intronic
1099529844 12:83764222-83764244 TGCAGGCACCATAGCGTGAATGG + Intergenic
1102864225 12:116361314-116361336 TGCAGGGACAATGGAGGGGAAGG + Intergenic
1103081303 12:118026131-118026153 TGCTGGGACCAGGCTGGGCATGG - Intronic
1103472760 12:121194990-121195012 TGAATGGAGCATAGTGGGCAAGG - Intergenic
1105808544 13:23973494-23973516 TGGAGGGATCACAGTGGGCAAGG - Intergenic
1107725251 13:43292760-43292782 TGAAGGGGCCATAGTGGCAACGG - Intronic
1108243691 13:48493589-48493611 TGGAGGGAGCACAGTGGGGAGGG - Intronic
1110812573 13:79826886-79826908 GGAAGGGACCATAGTGGGAAAGG + Intergenic
1115055810 14:29125183-29125205 TTCAGGGACCATAGTGATAAAGG + Intergenic
1115725813 14:36215103-36215125 TGCAGGGTGCATGGTGGGCCAGG + Intergenic
1116688497 14:48074030-48074052 TGCAGGGAACATAGATGGCTAGG + Intergenic
1117063315 14:51984412-51984434 TGCAGGGACCTTAGAGGGCTGGG - Intergenic
1121178132 14:91906381-91906403 TGCTGGGACCATAGAGGTGAGGG + Intronic
1121282519 14:92709578-92709600 GGCAGGGAGCATAGGAGGCAGGG + Intronic
1121607662 14:95253146-95253168 GTCAGGGGCCACAGTGGGCATGG - Intronic
1122027556 14:98888585-98888607 TCCACCGTCCATAGTGGGCATGG + Intergenic
1124214890 15:27798019-27798041 TGCAGGCACCAGGGTGTGCAGGG + Intronic
1124405237 15:29385858-29385880 ATCTGAGACCATAGTGGGCATGG + Intronic
1125277470 15:38008378-38008400 TGCAGGGATGATAGAGGGAAGGG + Intergenic
1125464214 15:39934470-39934492 TGCAAGGACTAAAGTGAGCATGG - Intronic
1129889880 15:79065031-79065053 GGCAGGGCCCATGGTTGGCATGG - Intronic
1130651301 15:85763608-85763630 TGCAGAGGCCACAGTGTGCAGGG + Intronic
1132405751 15:101541145-101541167 TGCAGGGTGCATGGTGGGCGTGG - Intergenic
1132723051 16:1326317-1326339 TGCAGGGTCCCAAGAGGGCAGGG + Exonic
1132738774 16:1400518-1400540 TGCAGGGACCAGGGAGGGGATGG + Intronic
1134052355 16:11145774-11145796 AGAATGGACCATAGAGGGCAAGG - Intronic
1135606116 16:23826232-23826254 TGCAGGGACCCTATTTGGGAAGG - Intergenic
1135925479 16:26689967-26689989 TGCTGGGAACATAGTGGCCATGG - Intergenic
1138206163 16:55126718-55126740 TGCAGGGAGCTTGGTGTGCATGG - Intergenic
1139069473 16:63362627-63362649 TGGAGGGATCATGGTGGGGATGG + Intergenic
1139378066 16:66513246-66513268 CGCAGAGACATTAGTGGGCAGGG + Intronic
1141378861 16:83557383-83557405 TCCACGGACCAGAGTGGGGATGG - Intronic
1141980606 16:87547740-87547762 AGCAGAGAACAGAGTGGGCAGGG + Intergenic
1142349114 16:89571635-89571657 TGCTGGGAACATTCTGGGCAAGG + Intergenic
1143378493 17:6480938-6480960 GCCAGGGCCCACAGTGGGCAAGG + Intronic
1144659641 17:17059835-17059857 TGCAGGGTCCCGGGTGGGCATGG + Intronic
1145124178 17:20286719-20286741 TGCAGTGACCAGAGAGGTCAAGG - Intronic
1146618715 17:34378762-34378784 TCCAGGGACAACAGTGAGCAGGG + Intergenic
1147909954 17:43849470-43849492 TGCAGGGACACTAGGGGGCCGGG + Intronic
1148078465 17:44953806-44953828 TGCAGGCAACAGAGTAGGCAAGG + Intergenic
1148153925 17:45411996-45412018 TGCAGGTAGCATGGGGGGCAGGG + Intronic
1149422399 17:56523318-56523340 TCCAGGGACCACAGAGGGGATGG - Intergenic
1150446892 17:65233057-65233079 TGCATGGACCAGACTGTGCATGG - Intergenic
1151215020 17:72571461-72571483 TGCAGGGTCCATGGTGACCAGGG + Intergenic
1152005146 17:77675918-77675940 TGCAGGGCCCACAGCGGGGAGGG - Intergenic
1152014994 17:77744696-77744718 GGCCAGGACCATAGTGGGCAGGG - Intergenic
1152076714 17:78164504-78164526 GGCAGGGGCCAGGGTGGGCATGG - Intronic
1152299392 17:79486232-79486254 GGCAGGGACCAGGGTGGGCGGGG + Intronic
1154948440 18:21184850-21184872 TGCAGGGAAGATAGTTGGCAGGG - Intergenic
1160491317 18:79338402-79338424 TGCTGGGAGCATGGTGGGGATGG - Intronic
1161228495 19:3159933-3159955 TCCAGGGACCAACGTGGGGAAGG + Intronic
1161245420 19:3249162-3249184 ACCAGGGACCATAGGGGGCGGGG + Intronic
1162026814 19:7899071-7899093 TGCGGCCACCATAGTGGCCATGG + Exonic
1163429150 19:17256567-17256589 TGCACGGGGCACAGTGGGCATGG + Exonic
1164720130 19:30425848-30425870 TGTAGGGACTGTGGTGGGCATGG + Intronic
1164946181 19:32295030-32295052 TACAGGAACCAATGTGGGCAAGG + Intergenic
1166038294 19:40185820-40185842 TGCAGGGTTCAGAGCGGGCATGG - Intergenic
1166843658 19:45713298-45713320 GGCAGGGACCTCAGTGGCCAAGG + Exonic
1166986923 19:46666193-46666215 TCAAGGGACAACAGTGGGCAAGG + Intergenic
1167452739 19:49581592-49581614 TCTAGGGACCTAAGTGGGCAGGG - Intronic
925656474 2:6155411-6155433 TGCAAGGACAAGAGTTGGCAGGG + Intergenic
926124357 2:10262806-10262828 TGGAGGAACCAAAGTGGGAAAGG + Intergenic
926166307 2:10523683-10523705 TGCTGGGCACACAGTGGGCAGGG + Intergenic
926671769 2:15583326-15583348 TGCAGGGACCAGAGGGGGCCTGG - Intergenic
926739461 2:16099263-16099285 TACATGGAACATATTGGGCAGGG + Intergenic
927510307 2:23640231-23640253 TGCAGGGAACATAATTGGGAGGG - Intronic
927661889 2:25000506-25000528 TGCAGAGGCCACAGTGGGGAGGG + Intergenic
930079967 2:47438107-47438129 TGCATAGACCATGGGGGGCAGGG - Intronic
931903751 2:66820759-66820781 TGTAGGGTCCTTCGTGGGCAGGG + Intergenic
932212673 2:69945435-69945457 TGCATGGAACAGAGTGGGCAGGG - Intergenic
932590005 2:73059528-73059550 TGCAGGGTCCTTATTGGGAAGGG - Intronic
932716811 2:74106512-74106534 GGCTGGGACCATGGTGGGCAGGG + Exonic
934526580 2:95055854-95055876 TGCTGGGACCATTGAGGGGATGG + Intergenic
935373705 2:102374107-102374129 TCCATGGACCAGGGTGGGCAGGG - Intronic
935736789 2:106112417-106112439 GGCAGGGACCCCAGTGGCCATGG + Intronic
936661422 2:114547995-114548017 TGCAGGGACCACAGTTGACGTGG + Intronic
937087116 2:119178824-119178846 AGCAGGGCCCAGGGTGGGCAGGG - Intergenic
938651715 2:133390170-133390192 GGCATGGACCACAGTGGGCCTGG - Intronic
938976117 2:136480342-136480364 TCCTGGGACCAGAGAGGGCAAGG + Intergenic
940450727 2:153833121-153833143 GGCAGGGAGCATAGTCAGCATGG - Intergenic
943354549 2:186835915-186835937 TGTAGGGTCACTAGTGGGCAGGG + Intronic
943400915 2:187409954-187409976 TGCAGGGACCACACTAAGCAGGG + Intronic
943728708 2:191279412-191279434 TTCAGGTACCATAGTGGGGTGGG + Intronic
945930512 2:215850373-215850395 TGCAGGGACCATTGCTGGCAAGG - Intergenic
947912672 2:233811683-233811705 AGCAGGGCCCAAAGTGGGCCTGG - Intronic
948634724 2:239327832-239327854 TGCAGGGAGCAGTGTGGGCCAGG - Intronic
948714001 2:239847191-239847213 TTCAGCTACCAGAGTGGGCAGGG - Intergenic
1171794071 20:29552840-29552862 GGCAGGGACCTTATTGGGTAGGG + Intergenic
1172213304 20:33216057-33216079 TGCAGGGACCCTCCTGGGCCTGG + Intergenic
1172700718 20:36852221-36852243 GGGAGGGACCATGGTGGCCAGGG - Intronic
1172941680 20:38658684-38658706 GGCAGGGGGCAGAGTGGGCAGGG + Intergenic
1174483712 20:50848521-50848543 AGCAGGGACCAGATTGTGCAGGG + Intronic
1175271046 20:57734432-57734454 TCCAGGGACCAACGGGGGCAGGG - Intergenic
1175975320 20:62707953-62707975 TGCAGGGCCCTGAGTGGGGAGGG + Intergenic
1179887084 21:44318816-44318838 TGCAGGGAGCCTGGTGAGCATGG + Intronic
1181362795 22:22351513-22351535 TGCAGGGGCCACAGTGTGAAGGG + Intergenic
1181722539 22:24786762-24786784 TGCAGGGAAGGTAGTGGGAATGG - Intergenic
1181776339 22:25162317-25162339 TGCAGGGAGCACTGTGGTCATGG - Intronic
1181854526 22:25772514-25772536 AGGTGGGACCATTGTGGGCAGGG + Intronic
1182495690 22:30705773-30705795 TGCAGTGACCACAATGTGCAAGG + Intronic
1182520902 22:30884043-30884065 TGCAGACCCCATAGTGGGCCTGG - Intronic
1183345029 22:37302888-37302910 GGCAGAGAACAGAGTGGGCAGGG + Intronic
1184029841 22:41886078-41886100 CTCAGGGAGCATAGTTGGCAAGG + Intronic
1185211579 22:49573541-49573563 AGCAAGGCCCAGAGTGGGCAGGG + Intronic
952172125 3:30818777-30818799 TGCAGTGACCAAATTGGACAAGG - Intronic
954875310 3:53799412-53799434 AGCAGGGACCACAGTGAGGAAGG + Intronic
958596767 3:96236092-96236114 TGCACGGACCAGAGTGGCTAGGG + Intergenic
964402699 3:156315435-156315457 TCCAGGGACCTCAGTGAGCAAGG - Intronic
969404705 4:6982863-6982885 TGCAGAGACCATATTTGGAAGGG + Intronic
969428766 4:7140838-7140860 TGCAGGGGACACAGCGGGCATGG + Intergenic
969989886 4:11251664-11251686 TTTAGGGAACATAGTTGGCATGG + Intergenic
971957890 4:33446106-33446128 TGCAGAAACCATTGTAGGCAGGG + Intergenic
972324888 4:38006044-38006066 AGCAGGGAGCAGAGAGGGCATGG + Intronic
974191174 4:58505474-58505496 TTCAGGGACCATAATATGCATGG + Intergenic
978035094 4:103983408-103983430 TCAAGTGACCATAGTGGGGAAGG - Intergenic
980244779 4:130224609-130224631 TGCAAGGAGCACAGTGGGAAGGG + Intergenic
981186091 4:141805480-141805502 TTCAGGGACAATAGTATGCATGG - Intergenic
981195229 4:141911851-141911873 TGAAGTGACCATGGCGGGCAAGG + Intergenic
982742805 4:159075159-159075181 TGCAGGGACGAGAGTGGAAATGG + Intergenic
987166506 5:15203611-15203633 TGAAGGGACATGAGTGGGCATGG + Intergenic
989644655 5:43617478-43617500 TGCAGAGAGCATAGTGTGAAAGG + Intronic
992668611 5:79036166-79036188 TGCATGGCACATAGTGGGCAAGG + Intronic
996683725 5:126257218-126257240 GGCATGGACTACAGTGGGCAGGG - Intergenic
997419241 5:133752748-133752770 TGCAGGGGTCATAGGGGGCAGGG + Intergenic
997729098 5:136152136-136152158 TGCTGGAACCATGGTGGGGAAGG - Intronic
999776462 5:154816202-154816224 GGCAGGCACCAGACTGGGCAGGG - Exonic
1001674186 5:173498951-173498973 TGCAGGGAACTTAGTGGGCTGGG - Intergenic
1001907380 5:175484371-175484393 TGCGGGCACCATCGTGGGGAGGG - Intronic
1003939950 6:11014571-11014593 GGCAAGGAGGATAGTGGGCATGG - Intronic
1003940418 6:11019647-11019669 GGCAAGGAGGATAGTGGGCATGG + Intronic
1004327444 6:14688271-14688293 TGGAGTGACCATAGTGTGCCAGG + Intergenic
1006010249 6:31037048-31037070 TGCAGGAAGCATTGTGTGCAAGG + Intergenic
1006060410 6:31414583-31414605 GGCAGAGCCCACAGTGGGCAGGG + Intronic
1006072855 6:31509355-31509377 GGCAGGGCCCACAGTGGGCAGGG + Intronic
1007655631 6:43449602-43449624 TTCAGGGACCCCAGTGGTCAGGG + Intronic
1008568084 6:52788919-52788941 TGCTGGGAGCATAGCTGGCAGGG + Intergenic
1008572272 6:52827499-52827521 TGCTGGGAGCATAGCTGGCAGGG + Intergenic
1008936666 6:56999628-56999650 AGGAGGGACCAAAATGGGCAGGG - Intronic
1009621543 6:66084536-66084558 TGCAGGGACCAAAGTGTTCCTGG + Intergenic
1009949768 6:70381923-70381945 TTCAGGGACAATAGTGTGCATGG - Intergenic
1013340808 6:109213806-109213828 TGGAGGGCACACAGTGGGCATGG + Intergenic
1017124355 6:151051777-151051799 GGCAGAGACCACAGTGGGCAGGG + Intronic
1018313327 6:162532582-162532604 TGTAGGGAACAGAGTGGGCAGGG - Intronic
1018799266 6:167210056-167210078 TGCAGGGGCCTTCCTGGGCATGG - Intergenic
1025013884 7:55423276-55423298 TGCAGGCTGCATTGTGGGCATGG + Intronic
1025030108 7:55549919-55549941 TGCAGTGACCATGATGGGGATGG - Intronic
1028961262 7:96751914-96751936 TGCAGGGACCACAGGCAGCAGGG + Intergenic
1033056338 7:138058409-138058431 GGCAGGGGCCGTAGTGGGTAGGG - Intronic
1033531669 7:142270471-142270493 TGCAGTGACAGTAGAGGGCAAGG - Intergenic
1034228668 7:149501961-149501983 TCCTGAGACCCTAGTGGGCACGG - Intergenic
1035244287 7:157552089-157552111 TGCAGTGGCCATAGAGTGCATGG - Intronic
1035324152 7:158054118-158054140 TGCAGAGACCCTAGAGAGCATGG + Intronic
1035385828 7:158472038-158472060 TGCAGGAACCGTGGTGGGAATGG - Intronic
1038855135 8:31322551-31322573 AGCAGGCACCACATTGGGCAGGG - Intergenic
1038987986 8:32834217-32834239 TGGAGAGTCCAAAGTGGGCAGGG + Intergenic
1039615240 8:38950399-38950421 TGCTGGAAACAGAGTGGGCAGGG - Intronic
1041693826 8:60714938-60714960 CGCAGGCGCCATAGTGGGGAGGG + Intronic
1044615810 8:94139601-94139623 AGGAAGAACCATAGTGGGCAGGG + Intronic
1046626736 8:116583626-116583648 TGCAGGGACCACAGTAGTCATGG + Intergenic
1048880802 8:138871068-138871090 TACAGGAATCAAAGTGGGCATGG - Intronic
1049428004 8:142545798-142545820 GGCAGGGACAATAGCGGGGAAGG + Intergenic
1049428061 8:142546039-142546061 TGCAGTGACCACAGTGACCATGG + Intergenic
1049439533 8:142602823-142602845 TGGAGGGACCAGAGGGGGCTAGG + Intergenic
1051156751 9:14156616-14156638 GGCAGGGTCCACAGTGGCCATGG + Intronic
1051750926 9:20340293-20340315 TGCAGGGACTATAGATGCCACGG + Intergenic
1056635871 9:88330805-88330827 TGCAGGCTCTATAGTGAGCATGG - Intergenic
1057139191 9:92716603-92716625 TGCTGGGCCCATGGTGGGCCTGG + Intronic
1058421116 9:104834543-104834565 TTCAGAAACCATACTGGGCAGGG - Intronic
1059461751 9:114435329-114435351 TGCAGGAACCAGAATGGGGAGGG - Intronic
1060930970 9:127489389-127489411 TGCAGGGAAAAGTGTGGGCACGG + Intronic
1061785146 9:133023364-133023386 AGCTGGGACCATAGGTGGCAGGG + Intergenic
1186349315 X:8727328-8727350 TGCAGGGACCATAGTGGGCAGGG - Intronic
1189710613 X:43807975-43807997 TGCAGAGACCATAGTGGGTCTGG - Intronic
1190687662 X:52888865-52888887 TGCAGGGAACATTGTGCCCAAGG + Intergenic
1190698320 X:52966927-52966949 TGCAGGGAACATTGTGCCCAAGG - Intronic
1192237072 X:69302769-69302791 AGCAGGGGCCTCAGTGGGCAAGG + Intergenic
1192341433 X:70266955-70266977 TGCAGGTACCACAGTGGGATAGG - Intergenic
1194961427 X:100240673-100240695 GGGAGGGTCCATTGTGGGCATGG + Intergenic
1196279960 X:113812487-113812509 TGAAGGGATCATGGAGGGCAAGG - Intergenic
1197861520 X:130976041-130976063 TGCAGTAACCATACTTGGCATGG - Intergenic
1199116696 X:144000564-144000586 TTCTGAGACCATAATGGGCAGGG + Intergenic
1199747789 X:150784931-150784953 TGCAGGGCGGAGAGTGGGCAGGG + Intronic
1200250141 X:154548414-154548436 AGAACAGACCATAGTGGGCAAGG + Intronic