ID: 1186349949

View in Genome Browser
Species Human (GRCh38)
Location X:8731234-8731256
Sequence GTGCGTGTATGCGCGTGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 989
Summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 945}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186349949_1186349959 14 Left 1186349949 X:8731234-8731256 CCCCAACACGCGCATACACGCAC 0: 1
1: 0
2: 4
3: 39
4: 945
Right 1186349959 X:8731271-8731293 TGGCACAAGTACCCTGGCTGGGG 0: 1
1: 0
2: 2
3: 12
4: 103
1186349949_1186349961 23 Left 1186349949 X:8731234-8731256 CCCCAACACGCGCATACACGCAC 0: 1
1: 0
2: 4
3: 39
4: 945
Right 1186349961 X:8731280-8731302 TACCCTGGCTGGGGCTCCAAGGG 0: 1
1: 0
2: 2
3: 15
4: 172
1186349949_1186349957 12 Left 1186349949 X:8731234-8731256 CCCCAACACGCGCATACACGCAC 0: 1
1: 0
2: 4
3: 39
4: 945
Right 1186349957 X:8731269-8731291 CTTGGCACAAGTACCCTGGCTGG 0: 1
1: 0
2: 2
3: 10
4: 105
1186349949_1186349956 8 Left 1186349949 X:8731234-8731256 CCCCAACACGCGCATACACGCAC 0: 1
1: 0
2: 4
3: 39
4: 945
Right 1186349956 X:8731265-8731287 ACGACTTGGCACAAGTACCCTGG 0: 1
1: 0
2: 2
3: 1
4: 50
1186349949_1186349960 22 Left 1186349949 X:8731234-8731256 CCCCAACACGCGCATACACGCAC 0: 1
1: 0
2: 4
3: 39
4: 945
Right 1186349960 X:8731279-8731301 GTACCCTGGCTGGGGCTCCAAGG 0: 1
1: 0
2: 3
3: 32
4: 251
1186349949_1186349953 -6 Left 1186349949 X:8731234-8731256 CCCCAACACGCGCATACACGCAC 0: 1
1: 0
2: 4
3: 39
4: 945
Right 1186349953 X:8731251-8731273 ACGCACCCTGGAACACGACTTGG 0: 2
1: 0
2: 0
3: 1
4: 51
1186349949_1186349964 26 Left 1186349949 X:8731234-8731256 CCCCAACACGCGCATACACGCAC 0: 1
1: 0
2: 4
3: 39
4: 945
Right 1186349964 X:8731283-8731305 CCTGGCTGGGGCTCCAAGGGTGG 0: 1
1: 0
2: 3
3: 57
4: 392
1186349949_1186349965 27 Left 1186349949 X:8731234-8731256 CCCCAACACGCGCATACACGCAC 0: 1
1: 0
2: 4
3: 39
4: 945
Right 1186349965 X:8731284-8731306 CTGGCTGGGGCTCCAAGGGTGGG 0: 1
1: 0
2: 3
3: 37
4: 309
1186349949_1186349958 13 Left 1186349949 X:8731234-8731256 CCCCAACACGCGCATACACGCAC 0: 1
1: 0
2: 4
3: 39
4: 945
Right 1186349958 X:8731270-8731292 TTGGCACAAGTACCCTGGCTGGG 0: 1
1: 0
2: 1
3: 11
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186349949 Original CRISPR GTGCGTGTATGCGCGTGTTG GGG (reversed) Intronic
900581106 1:3409942-3409964 GTGGGTGTGTGTGCGTGTGGGGG + Intronic
900901094 1:5516540-5516562 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
901520247 1:9778219-9778241 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
902074955 1:13777067-13777089 CTGTGTGCATGTGCGTGTTGTGG - Intronic
902217378 1:14943034-14943056 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
902332803 1:15738777-15738799 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
902391918 1:16111903-16111925 GTGTGTGTGTGCACGTGGTGGGG - Intergenic
902741529 1:18441941-18441963 GTGTGTGTGTGTGTGTGTTGCGG + Intergenic
903007784 1:20309939-20309961 GTGTGTGTGTGTGTGTGTTGCGG + Intronic
903589792 1:24446090-24446112 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
904346774 1:29877746-29877768 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
906929216 1:50152407-50152429 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
907517397 1:55001228-55001250 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
908127289 1:61043825-61043847 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
908512526 1:64860844-64860866 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
908571445 1:65415445-65415467 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
908685696 1:66716896-66716918 GTGTGTGTATGTGAGTGTGGTGG - Intronic
908713019 1:67039511-67039533 GTGTGTGTGTGCGCGCGTGGGGG + Intronic
908768927 1:67578356-67578378 GTGTGTGTGTGTGTGTGTTGAGG + Intergenic
908835956 1:68230597-68230619 GTGTGTGTGTGTGTGTGTTGAGG + Intronic
909418597 1:75435856-75435878 GTGTGTGTATGTGTGTGTGGTGG - Intronic
909507943 1:76416030-76416052 GTGTGTGTGTGTGTGTGTTGTGG - Intronic
909745583 1:79093240-79093262 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
910734848 1:90442369-90442391 GTGTGTGTGTGTGCATGTTGAGG + Intergenic
911102400 1:94104942-94104964 GTGTGTGTGTGCGTGTGTTGGGG - Intronic
911218241 1:95218862-95218884 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
911270042 1:95790265-95790287 ATGTGTGTGTGTGCGTGTTGGGG + Intergenic
911367138 1:96952213-96952235 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
911664511 1:100538631-100538653 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
911876324 1:103167996-103168018 GTGTGTGTGTGTGCGGGTTGGGG + Intergenic
912300027 1:108505314-108505336 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
912443798 1:109717947-109717969 GTGTGTGTGTGTGTGTGTTGGGG + Exonic
912933499 1:113983718-113983740 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
913225838 1:116697390-116697412 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
914244554 1:145876040-145876062 GTGTGTGTTTGTGTGTGTTGGGG - Intronic
915044922 1:153004248-153004270 GTGTGTGTATGTGTGTGGTGGGG - Intergenic
915127777 1:153678260-153678282 GTGCGTGGATGTGTGTGTTTGGG - Intergenic
915722086 1:157993222-157993244 GTATGTGTGTGCGCGCGTTGTGG + Intergenic
915833497 1:159153577-159153599 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
916088911 1:161291810-161291832 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
916197702 1:162240267-162240289 GTGTGTGTGTGTGTGTGTTGAGG + Intronic
916322922 1:163524905-163524927 GTGTGTGTGTGTGTGTGTTGCGG + Intergenic
918358120 1:183724960-183724982 GTGTGTGTGTGTGTGTGTTGTGG - Intronic
918391659 1:184070242-184070264 GTGTTTGTATGTGTGTGTTGGGG - Intronic
918439138 1:184548210-184548232 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
918674570 1:187266896-187266918 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
918948287 1:191099457-191099479 GTGCGTGTGTGTGTGTGTAGTGG - Intergenic
919059355 1:192611290-192611312 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
919084450 1:192905370-192905392 GTGTGTGTATGAGTGTATTGAGG + Intergenic
919109048 1:193193813-193193835 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
919193531 1:194253920-194253942 GTGTGTGTATGTGTGTGGTGAGG - Intergenic
919915797 1:202138290-202138312 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
920349903 1:205331064-205331086 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
920612801 1:207458055-207458077 GTGTGTGTGTGTGTGTGTTGTGG - Intronic
921070438 1:211653812-211653834 GTGTGTGTGTGTGTGTGTTGCGG - Intergenic
921335790 1:214084500-214084522 GTGTGTGTGTGTGTGTGTTGAGG - Intergenic
921973188 1:221173470-221173492 GTGTGTGTATGTGTGTGTGGTGG + Intergenic
922127057 1:222738028-222738050 GTGTGAGTATGTGTGTGTTGGGG + Intronic
922420690 1:225459491-225459513 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
922456238 1:225775852-225775874 GTGTGTGTGTGTGTGTGTTGAGG - Intergenic
922881886 1:228987228-228987250 GTGTGTGTATGCGTGTGGGGGGG - Intergenic
922924687 1:229338534-229338556 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
923502558 1:234578208-234578230 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
924215744 1:241820034-241820056 GTGTGTGTGTGTGTGTGTTGAGG + Intergenic
1062794836 10:336861-336883 TGGTGTGTGTGCGCGTGTTGTGG + Intronic
1062794841 10:336904-336926 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1062794845 10:336943-336965 GTGCGCGTGTGTGTGTGTTGTGG + Intronic
1062794853 10:337015-337037 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1062794857 10:337056-337078 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1063457260 10:6192695-6192717 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1063651668 10:7944119-7944141 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1064570038 10:16683167-16683189 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1064584466 10:16825657-16825679 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1065196918 10:23275574-23275596 GTGTGTGTATGTGTGTGTAGGGG - Intronic
1065701409 10:28429526-28429548 GTGCGTGCATGTGTGTGTGGGGG + Intergenic
1066048872 10:31617767-31617789 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1067066111 10:43105194-43105216 GTGCTTGTCCGCGCGTGCTGTGG + Intronic
1067824308 10:49558974-49558996 GTGTGTGTATGTGTGTGTTTAGG + Intergenic
1067941959 10:50664443-50664465 GTGTGTGTATTTGCGTGCTGGGG - Intergenic
1068362857 10:56002212-56002234 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1068877044 10:62008057-62008079 GTGTGTGTGTGTGTGTGTTGTGG - Intronic
1069266619 10:66466309-66466331 GTGCGTGTATGTGTGTGTGTGGG - Intronic
1069373884 10:67774294-67774316 GTGTGTGTGTGTGCATGTTGAGG - Intergenic
1069778916 10:70942693-70942715 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1070410917 10:76139422-76139444 GTGCGTCTGTGCGTGTGTAGAGG - Intronic
1070528407 10:77314919-77314941 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1070772972 10:79093131-79093153 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1070805697 10:79269452-79269474 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1071204322 10:83255886-83255908 GTACGTGTGTGTGTGTGTTGGGG - Intergenic
1071290736 10:84187248-84187270 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1072107625 10:92289910-92289932 GTGTGTGTATGTGTGTGGTGGGG + Intronic
1072816327 10:98512808-98512830 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1073035726 10:100562988-100563010 GTGGGTGGACGGGCGTGTTGAGG + Intergenic
1073046857 10:100644496-100644518 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1073131688 10:101193148-101193170 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1073153906 10:101331365-101331387 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
1073299047 10:102459667-102459689 GTGCGTGTATGTGTGGCTTGGGG + Intergenic
1073578561 10:104643728-104643750 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1073747345 10:106484332-106484354 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1073935219 10:108623301-108623323 GTGCGTGTGTGTGTGTGTAGAGG + Intergenic
1074283097 10:112071583-112071605 GTGCATGTGTGCATGTGTTGGGG - Intergenic
1074454612 10:113586458-113586480 GTGCGTGTGTGTGTGTGTGGGGG + Intronic
1074465520 10:113678626-113678648 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
1074465544 10:113678800-113678822 ATGCGTGTGTGTGTGTGTTGTGG + Intergenic
1074946192 10:118283116-118283138 GTGCGTGTGTGTGTGTGGTGTGG - Intergenic
1075516711 10:123114646-123114668 GTGTGTGTGTGTGTGTGTTGCGG - Intergenic
1075557750 10:123445594-123445616 GTGCATGTGTGTGCATGTTGGGG + Intergenic
1075645089 10:124091999-124092021 GCGCGAGTGTGTGCGTGTTGAGG - Intronic
1075875063 10:125799393-125799415 GTGTGTCTATGTGTGTGTTGGGG + Intronic
1075893294 10:125972889-125972911 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1075895524 10:125991261-125991283 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1075956306 10:126526019-126526041 GTGTGTGTGTGTGTGTGTTGTGG - Intronic
1076330474 10:129660771-129660793 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1077755088 11:5019705-5019727 GTGTGTGTGTGTGTGTGTTGAGG + Intergenic
1077772032 11:5229715-5229737 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1078120247 11:8500335-8500357 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1078738057 11:14039422-14039444 GTGTGTGTATGTGTGTGTAGGGG + Intronic
1078778022 11:14411494-14411516 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1079128350 11:17734270-17734292 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1079282757 11:19102614-19102636 GTGTGTGTGTGTGTGTGTTGAGG - Intergenic
1079732681 11:23955140-23955162 GTGTGTGTGTGTGTGTGTTGAGG + Intergenic
1079899589 11:26165389-26165411 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1080156579 11:29118465-29118487 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1080318541 11:30978775-30978797 GTGTGTGTGTGTGTGTGTTGAGG - Intronic
1080540426 11:33258467-33258489 GTGCGTGTGTGTGATTGTTGGGG + Intronic
1080567109 11:33520680-33520702 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1080999416 11:37650038-37650060 GTGTGTGTATGCATGTGTAGGGG - Intergenic
1081373937 11:42337491-42337513 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1081504985 11:43706704-43706726 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1081681416 11:45008018-45008040 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1081977647 11:47245868-47245890 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1082276149 11:50223611-50223633 GTGTGTGTGTGTGTGTGTTGCGG - Intergenic
1083640696 11:64143739-64143761 GTGTGTGTATGTGTGTGTCGGGG - Intronic
1083681351 11:64353258-64353280 GTGGGGGTATGGGCGTGTGGTGG + Intronic
1084409084 11:68995914-68995936 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1084646309 11:70460663-70460685 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1084679495 11:70658204-70658226 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1085042999 11:73337895-73337917 GTGCGTGTATGCACCTGGGGTGG - Intronic
1085297963 11:75441552-75441574 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1085448277 11:76615545-76615567 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1085507305 11:77067653-77067675 GTGTGTGTGTGTGTGTGTTGCGG + Intronic
1085683144 11:78596803-78596825 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1085781226 11:79410942-79410964 GTGTGTGTATGTGTGTGTAGAGG - Intronic
1085784175 11:79437238-79437260 GTGTGTGTGTGCATGTGTTGGGG - Intronic
1086841178 11:91686336-91686358 GTGCGTGTGTGTGCGTGTGCTGG - Intergenic
1087161827 11:94956425-94956447 GTGTGTGTGTGCGCGTGTGATGG + Intergenic
1087183397 11:95160834-95160856 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1087781456 11:102305124-102305146 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1088021111 11:105120672-105120694 GTGTGTGTATGTGTGTGTTGGGG - Intergenic
1088234283 11:107705826-107705848 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1088543632 11:110938292-110938314 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1088997676 11:115016038-115016060 GTTTGTGTGTGTGCGTGTTGGGG + Intergenic
1089015726 11:115163702-115163724 GTGCGTGTGTGTGTGTGGTGTGG - Intergenic
1089324943 11:117650699-117650721 GTGCGTGTGTGTGTGTGGTGGGG + Intronic
1089777599 11:120849152-120849174 GTGTGTGTGTGCGCGCGTTGGGG - Intronic
1090807896 11:130213751-130213773 GCGCGTGTGTGTGTGTGTTGGGG + Intergenic
1090888110 11:130897337-130897359 GTGTGTGTGTGTGAGTGTTGGGG - Intronic
1091129885 11:133136859-133136881 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1091150741 11:133326334-133326356 GTGTGTGTATGTGTGTGTGGGGG + Intronic
1091150798 11:133326625-133326647 GTGGGTGTATGTGGGTGTTGGGG + Intronic
1091535360 12:1402610-1402632 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1091616883 12:2056221-2056243 GTGTGTGTGTGTGTGTGTTGAGG + Intronic
1091635216 12:2191767-2191789 GTGCATGTATGTGCCTGTGGAGG - Intronic
1091713775 12:2761535-2761557 GTGTGTGCATGTGTGTGTTGGGG - Intergenic
1091726308 12:2848858-2848880 GTGCGTGTGTGTGTCTGTTGGGG - Intronic
1092049135 12:5455529-5455551 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1092204717 12:6607667-6607689 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1092482070 12:8868458-8868480 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1092937076 12:13374092-13374114 GTGTGTGCATGTGTGTGTTGGGG + Intronic
1093112997 12:15175371-15175393 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1093379492 12:18475369-18475391 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1093787292 12:23207360-23207382 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1093788419 12:23218525-23218547 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1094098757 12:26738000-26738022 GTGCGTGTGTGTGTGTGTTGTGG - Intronic
1094211639 12:27899580-27899602 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1094221214 12:27995631-27995653 GTGTGTCTATGGGCATGTTGTGG - Intergenic
1094260470 12:28491941-28491963 GTGCGTGTATGAAGGTGTTGGGG + Intronic
1094282109 12:28751796-28751818 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1095211813 12:39503069-39503091 GTGTGTGTATGTGTGTGGTGGGG - Intergenic
1095909041 12:47407045-47407067 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1096257154 12:50070404-50070426 GGGCGTGTGTGTGTGTGTTGGGG + Intronic
1096451589 12:51747115-51747137 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1096592307 12:52668515-52668537 GTGCGTGTGTGTGTGTGTTGTGG - Intergenic
1096793358 12:54058973-54058995 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1097555188 12:61127785-61127807 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1097636077 12:62123720-62123742 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1097636085 12:62123767-62123789 GTGTGTGTATGTGTGTGGTGGGG - Intronic
1097931644 12:65193758-65193780 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1098359152 12:69638348-69638370 GTGTGTGTGTGTGTGTGTTGAGG + Intergenic
1098761413 12:74429923-74429945 GTGTGTGTGTGTGTGTGTTGAGG - Intergenic
1098770153 12:74541138-74541160 GTGTGTGTATGTGTGTGTTATGG + Exonic
1098981561 12:76962129-76962151 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1099301945 12:80907081-80907103 GTGTGTGTGTGTGTGTGTTGAGG + Intronic
1099767613 12:87008570-87008592 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
1099884315 12:88508567-88508589 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1099941612 12:89195647-89195669 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1100889117 12:99104255-99104277 ATGCGTGTATGTGTATGTTGGGG + Intronic
1101243910 12:102866436-102866458 ATGCGTGTATGTGTGTGTGGGGG - Intronic
1101576608 12:106002855-106002877 GTGTGTGTATGTGTGTGATGAGG - Intergenic
1101717273 12:107321472-107321494 GTGTGTGTTTGTGTGTGTTGGGG + Intronic
1102012050 12:109624713-109624735 GTGTGTGTATGTGCGTGTGCAGG + Intergenic
1102346473 12:112164086-112164108 GTGAGTGTGTGCGCGTGTCAGGG - Intronic
1102871187 12:116415407-116415429 GTGCCTGTATGAGCGTGTCTGGG + Intergenic
1103055371 12:117816023-117816045 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1103165782 12:118769315-118769337 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1103210044 12:119159001-119159023 GTGTGTGTGTGTGTGTGTTGGGG + Exonic
1103360786 12:120352375-120352397 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1103452834 12:121041540-121041562 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1103797276 12:123513088-123513110 GTGCGTGTATGTCTGTGTGGTGG + Intronic
1103954321 12:124567803-124567825 GTGCGTGTCTGTGTGTGTGGCGG - Intergenic
1104112288 12:125715412-125715434 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1104478042 12:129086214-129086236 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1104513152 12:129399877-129399899 GTGCGTGTGTGTGTGTGTGGGGG + Intronic
1104894716 12:132158536-132158558 GTGTGTGTGTGCGCATGTAGTGG - Intergenic
1105577805 13:21669894-21669916 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1105601262 13:21889993-21890015 GTGTGTGTGTGCGCGTGTGTAGG + Intergenic
1105937456 13:25115414-25115436 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1105937461 13:25115466-25115488 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1105937466 13:25115508-25115530 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1105969910 13:25419083-25419105 GTGTGTGCACGCACGTGTTGAGG + Intronic
1106059054 13:26268252-26268274 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1106219984 13:27738287-27738309 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1106305658 13:28506876-28506898 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1106841561 13:33690178-33690200 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1107027184 13:35814254-35814276 GTGCGTGTGTGCGCGCGTGCAGG - Intronic
1107030821 13:35852009-35852031 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1107203574 13:37752973-37752995 GTGCGTGTGTGTGTGTGTGGAGG - Intronic
1107820088 13:44277751-44277773 GTGCGTGTATGTGTATGTTATGG - Intergenic
1107820427 13:44281017-44281039 GTGTGTGTGTGTGCATGTTGGGG - Intergenic
1107846077 13:44514497-44514519 GTGTGTGTATGTGTGTGTTTTGG - Intronic
1108065698 13:46575528-46575550 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1108244269 13:48499107-48499129 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1108626351 13:52232578-52232600 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1108646628 13:52436214-52436236 GTGTGTGTGTGTGTGTGTTGTGG - Intronic
1108739148 13:53317278-53317300 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1109417171 13:62055928-62055950 GTGTGTGTATGTGTGTGTGGTGG - Intergenic
1109539339 13:63752270-63752292 GTGTGTGTGTGTGTGTGTTGAGG + Intergenic
1109544505 13:63827564-63827586 GTGTGTGTGTGTGTGTGTTGAGG - Intergenic
1110671241 13:78181355-78181377 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1110798683 13:79669994-79670016 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1111531773 13:89545879-89545901 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1111768005 13:92559352-92559374 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1112163992 13:96898118-96898140 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1112562141 13:100524395-100524417 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1113020638 13:105882375-105882397 GTGTGTGTGTGTGTGTGTTGAGG - Intergenic
1113036914 13:106060880-106060902 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1113428585 13:110230170-110230192 GTGAGTGTGTGCCCGTGGTGTGG + Intronic
1113667444 13:112150765-112150787 GTGTGTGTGTGCGCTTGCTGTGG - Intergenic
1113901399 13:113800325-113800347 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1114626699 14:24135101-24135123 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1114927231 14:27419307-27419329 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1115056120 14:29129272-29129294 GTGTGTGTATGTGTGTGTAGGGG - Intergenic
1115125425 14:29987318-29987340 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1115369203 14:32593007-32593029 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1115400017 14:32946329-32946351 GTGCGCGTGTGTGTGTGTTGGGG - Intronic
1115841895 14:37481556-37481578 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1115901631 14:38157613-38157635 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1116373230 14:44162770-44162792 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
1116776669 14:49189191-49189213 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1117903437 14:60559797-60559819 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1118043044 14:61938022-61938044 GTGTGTGTGTGTGTGTGTTGCGG - Intergenic
1119144812 14:72302661-72302683 GTATGTGTATGTGTGTGTTGGGG - Intronic
1119262801 14:73247664-73247686 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1119262836 14:73247918-73247940 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1119262872 14:73248181-73248203 GTGTGTGTCTGTGTGTGTTGTGG + Intronic
1119262884 14:73248257-73248279 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1119717062 14:76866958-76866980 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1119871971 14:78025821-78025843 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1120015706 14:79470980-79471002 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1120435306 14:84474325-84474347 GTGTGTGTGTGCATGTGTTGTGG + Intergenic
1120476059 14:84988833-84988855 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1120497411 14:85254069-85254091 GTGTGTGTGTGCGCGCGTTGTGG - Intergenic
1120653819 14:87165780-87165802 GTGTGTGTATGTGTGTGTTGGGG - Intergenic
1120749183 14:88182027-88182049 GTGTGTGTGTGTGCGGGTTGGGG - Intronic
1120831365 14:89000439-89000461 GTGCGTGTATTGGGGTATTGGGG - Intergenic
1121374605 14:93396791-93396813 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1121660751 14:95633242-95633264 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1121843389 14:97153011-97153033 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1121843678 14:97155240-97155262 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1121860861 14:97316750-97316772 GTGTGTGTGTGTGTGTGTTGAGG + Intergenic
1121901011 14:97693555-97693577 GTGCATTTATGTGCCTGTTGAGG - Intergenic
1122153926 14:99739138-99739160 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1122163579 14:99804294-99804316 ATGCGTGTATGTGTGTGTTTAGG + Intronic
1122209912 14:100167311-100167333 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1122209936 14:100167399-100167421 GGGCGTGTGTGTGTGTGTTGGGG - Intergenic
1122210047 14:100167882-100167904 GTGAGTGTGTGTGTGTGTTGGGG - Intergenic
1122210104 14:100168115-100168137 GTGGGGGTATGTGTGTGTTGGGG - Intergenic
1122283075 14:100635757-100635779 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1122980016 14:105187151-105187173 GTGCGTGTGTGTGAGTGTGGGGG + Intergenic
1123175663 14:106416416-106416438 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1124250923 15:28106284-28106306 GCGCGTGTGTGCATGTGTTGGGG + Intergenic
1124377626 15:29138709-29138731 GTGTGTGTGTGTGTGTGTTGAGG + Intronic
1124869277 15:33524115-33524137 GTGTGTGTATGTGTGTGTAGGGG - Intronic
1124921592 15:34031996-34032018 GCGCGCGTATGTGTGTGTTGAGG - Intronic
1125486271 15:40113045-40113067 GTGTGTGTATGCGTGTGTGCGGG + Intergenic
1126282405 15:46970027-46970049 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1126296178 15:47137749-47137771 GTGTGTGTATTTGTGTGTTGTGG + Intergenic
1126348119 15:47717785-47717807 GTGTGTGTGTGCGCGCGGTGGGG + Intronic
1127122499 15:55783877-55783899 GTGTGTGTGTGTGTGTGTTGAGG - Intergenic
1127340131 15:58032785-58032807 GTGTGTGTGTGTGTGTGTTGAGG - Intronic
1127526399 15:59796438-59796460 GTGTGTGCATGTGTGTGTTGGGG - Intergenic
1127674593 15:61228028-61228050 GTCTGTGTCTGCGTGTGTTGGGG - Intronic
1127848779 15:62895255-62895277 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1128078474 15:64842442-64842464 GTGTGTGTATGTGTGTGTTGGGG + Intronic
1128078483 15:64842501-64842523 GTGTGTGTATGTGTGTGTTGGGG + Intronic
1128650517 15:69409219-69409241 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1128896450 15:71377863-71377885 GTGTGTGTGTGTGTGTGTTGTGG - Intronic
1129086478 15:73098078-73098100 GTGTGTGTGTGTGTGTGTTGTGG - Intronic
1129170582 15:73805099-73805121 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1129460150 15:75696506-75696528 GTGTGTGTGTGCGCGTGTGTGGG + Intronic
1130185356 15:81675777-81675799 GTGTGTGTATGTGTGTGTGGGGG - Intergenic
1130447703 15:84019062-84019084 GTGTGTGTATGTGTGTGTGGTGG - Intronic
1130757436 15:86779916-86779938 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1130834861 15:87640276-87640298 GTGCCTGTATGTGTGTGCTGGGG + Intergenic
1130852102 15:87804817-87804839 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1130861217 15:87892079-87892101 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1130879026 15:88039114-88039136 GTGTGTGTGTGTGTGTGTTGAGG - Intronic
1131587814 15:93715395-93715417 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
1132100859 15:99021968-99021990 GTGTGTGTATGTGTGTGTGGAGG + Intergenic
1132640913 16:977973-977995 GTGCGTGTATGTGTGTGGTGGGG - Intronic
1133229026 16:4357749-4357771 GTGCGTGTGTGTGTGTGTTAGGG + Intronic
1133542848 16:6773106-6773128 GTGCGTGTATGTGTATATTGGGG + Intronic
1133619994 16:7517171-7517193 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1133743913 16:8673422-8673444 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1134115418 16:11544186-11544208 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1134389832 16:13809090-13809112 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1135128602 16:19833091-19833113 GTGTGTGTATGTGTGTGGTGAGG + Intronic
1135486107 16:22866390-22866412 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1136503427 16:30686643-30686665 GTGCGTGTATGTGTGTGTGACGG - Intergenic
1136925919 16:34374097-34374119 GTGTGTGTGTGCGCGCTTTGAGG + Intergenic
1136978655 16:35037709-35037731 GTGTGTGTGTGCGCGCTTTGAGG - Intergenic
1137273062 16:46915672-46915694 GTGTGTGTATAGGTGTGTTGAGG - Intronic
1137501425 16:49014429-49014451 GTGCGTGTGTGTGTGTGTTGAGG + Intergenic
1137826206 16:51497979-51498001 GTGTGTGTGTGTGCATGTTGAGG - Intergenic
1138116163 16:54362373-54362395 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1138478072 16:57283838-57283860 GTGCCTGAGTGTGCGTGTTGGGG + Intronic
1138522948 16:57582121-57582143 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1138931520 16:61663872-61663894 GTGTGTGTATGTGTGTCTTGAGG + Intronic
1138937468 16:61746552-61746574 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1139037260 16:62962448-62962470 GTGTGTGTATGTGTGTGTGGAGG + Intergenic
1139401880 16:66688523-66688545 GTGTGTGTGTGTGTGTGTTGAGG - Intronic
1140785207 16:78334789-78334811 GTGCGTGTGTGTGTGTGTGGAGG - Intronic
1141347277 16:83258722-83258744 GTGTTTGTATGTGCGCGTTGTGG + Intronic
1141492504 16:84383743-84383765 GTGTGTGTATGTGTGTGTTGGGG + Intronic
1141787101 16:86208871-86208893 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1141826276 16:86482599-86482621 GTGTCTGTGTGCGCGTGGTGGGG + Intergenic
1141983429 16:87563992-87564014 GTGTGTGTGCGCGTGTGTTGGGG + Intergenic
1142034019 16:87852670-87852692 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1142034023 16:87852735-87852757 GTGCGTGTGTGTGTGTGTTTTGG + Intronic
1142283729 16:89162388-89162410 GTGTGTATGTGCGCGTGTGGAGG - Intergenic
1142518392 17:488993-489015 GTGTGTGTTTGTGTGTGTTGGGG + Intergenic
1142518397 17:489031-489053 GTGTGTGTTTGTGTGTGTTGGGG + Intergenic
1142754391 17:2007333-2007355 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1143015421 17:3888918-3888940 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1143019068 17:3907311-3907333 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1143461555 17:7107601-7107623 GTGTGTGTATGCATGTGTGGTGG - Intronic
1143564618 17:7714149-7714171 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1143590537 17:7884067-7884089 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1144580024 17:16453293-16453315 GTGCGTGTGTGTGTGTGTTTAGG - Intronic
1145757291 17:27401902-27401924 GTGCGTGTGTGTGTGTGTTAGGG - Intergenic
1145770733 17:27491335-27491357 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1146143768 17:30391663-30391685 GTGCGTGTGTGTGTGTGGTGTGG + Intronic
1146601966 17:34225229-34225251 GCGCGCGTGCGCGCGTGTTGGGG - Intergenic
1146665281 17:34698128-34698150 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1146828507 17:36046047-36046069 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1146908955 17:36635685-36635707 GTGTGTGTAAGTGTGTGTTGGGG - Intergenic
1146967677 17:37046726-37046748 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1147163372 17:38580273-38580295 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1147227772 17:38993419-38993441 GTGCGCGTGTGTGTGTGTTGGGG + Intergenic
1147237974 17:39071701-39071723 GTGGGTGTGTGTGTGTGTTGTGG - Intronic
1147341543 17:39755559-39755581 GTGTGTGTTTGTGTGTGTTGAGG - Intergenic
1147382032 17:40061970-40061992 GTGTGTGTATGTGTGTGCTGGGG + Intronic
1147395604 17:40140313-40140335 GTGTGTGTGTGTGTGTGTTGGGG - Exonic
1147395610 17:40140369-40140391 GTGTGTGTGTGTGTGTGTTGGGG - Exonic
1147443055 17:40459102-40459124 GTGAGTGTATGGGCTTTTTGGGG + Intergenic
1147568581 17:41552793-41552815 GTGTGTGTTTGTGTGTGTTGGGG - Intergenic
1147779585 17:42930940-42930962 GTGTGTGTATGTGTGTTTTGGGG - Intergenic
1147995434 17:44357741-44357763 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1148104337 17:45111386-45111408 GTGTGTGTGTGTGTGTGTTGTGG + Exonic
1148142250 17:45337244-45337266 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1148330173 17:46809469-46809491 GTGTGTGTACGTGTGTGTTGGGG - Intronic
1148331461 17:46816464-46816486 GTGTGTGTGTGCGTGTGTTCTGG - Intronic
1148346304 17:46905804-46905826 GTGTGTGTGTGCGTTTGTTGGGG + Intergenic
1148478394 17:47944219-47944241 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1148485578 17:47988678-47988700 GTGTGTGTATGTGTGTGTGGGGG - Intergenic
1148578469 17:48727432-48727454 GTGTGTGTATGCGCATGTATTGG - Intronic
1148647736 17:49228959-49228981 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1148754120 17:49963611-49963633 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
1148784453 17:50139212-50139234 GTGCGTGCATGTGTGTGTTGAGG - Intronic
1149051895 17:52314887-52314909 GAGTGTGTATGTGTGTGTTGAGG - Intergenic
1149117985 17:53122190-53122212 GTGTGTGTATGTGTGTGTAGAGG + Intergenic
1149421588 17:56516272-56516294 GTGTGTGTGTGCGTGTGTGGTGG + Intergenic
1149432809 17:56607977-56607999 GTGCGTGTGTGTGTGTGTTTTGG + Intergenic
1149593844 17:57851670-57851692 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1150439488 17:65179665-65179687 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1151267979 17:72971303-72971325 GTGTGTGTATGTGTGTGTGGAGG - Intronic
1151506406 17:74530546-74530568 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1151593518 17:75062695-75062717 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1151772753 17:76175991-76176013 GTGCGTGTATGTGTGTGTACAGG - Intronic
1151888653 17:76939058-76939080 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1151930089 17:77226896-77226918 GTGTGTGTATGTGTGTGTTTGGG + Intergenic
1152048121 17:77952153-77952175 GTGCATGCATGCATGTGTTGGGG - Intergenic
1152426898 17:80222925-80222947 GTGCGTGTGTGTGCGTGTTGGGG + Intronic
1152575455 17:81138565-81138587 GTGTGGGTATGTGCGTGTGGGGG - Intronic
1152797630 17:82315952-82315974 GTGCGCGTGTGCGCGTGTGCAGG - Intronic
1153294789 18:3535096-3535118 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1155075574 18:22351183-22351205 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1155323939 18:24647142-24647164 GAGTGTGTATGTGCATGTTGGGG - Intergenic
1155554799 18:27006991-27007013 GTGCGTGTATATGCGTGTGTGGG + Intronic
1155661137 18:28249501-28249523 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1155760783 18:29563097-29563119 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1156040420 18:32814597-32814619 GTGCGTGTATGTGTGTATTTGGG - Intergenic
1156170378 18:34476406-34476428 GTGTGTGTGTGTGTGTGTTGAGG - Intergenic
1156310023 18:35913239-35913261 GTGCGTGTGTGTGTGTGTGGTGG - Intergenic
1156590053 18:38477149-38477171 GTGTGTGTGTGTGTGTGTTGAGG + Intergenic
1156789773 18:40956674-40956696 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1156801031 18:41114200-41114222 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1156917255 18:42476402-42476424 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1157588780 18:48822501-48822523 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1157791440 18:50535219-50535241 GTGTGTGTATGTGTGTGGTGTGG + Intergenic
1157791450 18:50535284-50535306 GTGTGTGTATGTGTGTGGTGTGG + Intergenic
1158109133 18:53920556-53920578 GTGCGTGTATGTGTGTGGTGTGG + Intergenic
1158262424 18:55622887-55622909 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1158293503 18:55968683-55968705 GTGTGTGTATGGGAGTGGTGGGG + Intergenic
1158429205 18:57368963-57368985 GTGTGTGTATGTGTGTGTGGGGG - Intronic
1158819318 18:61140982-61141004 GTGTGTGTGTGTGTGTGTTGAGG - Intergenic
1159241646 18:65750581-65750603 GTGTGTGTGTGCGCGCGTGGCGG + Intronic
1159532392 18:69670974-69670996 GTGCGTGTGTGTGTGTGTTGGGG - Intronic
1159690040 18:71476500-71476522 GTGTGTGTGTGTGTGTGTTGAGG - Intergenic
1159831702 18:73285190-73285212 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1159903873 18:74073133-74073155 GTGTGTGTATGTGTGTGTAGGGG - Intergenic
1160135767 18:76270219-76270241 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1160350215 18:78172209-78172231 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1161248271 19:3267105-3267127 GTGCGTGTGCGTGTGTGTTGGGG + Intronic
1161572072 19:5036213-5036235 GTGCATGTATGTGTGTGGTGGGG + Intronic
1164024394 19:21338079-21338101 GTGTGTGTTTGTGTGTGTTGGGG - Intergenic
1165137936 19:33682153-33682175 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1165159237 19:33806104-33806126 GTGTGTGTATGCCTGTGTTGTGG + Intronic
1165511614 19:36269535-36269557 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1165512713 19:36274557-36274579 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1165513264 19:36277100-36277122 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1165513819 19:36279653-36279675 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1165514368 19:36282187-36282209 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1165514922 19:36284726-36284748 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1165515474 19:36287257-36287279 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1165516024 19:36289795-36289817 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1165516575 19:36292330-36292352 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1165517127 19:36294858-36294880 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1165517679 19:36297381-36297403 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1165518232 19:36299916-36299938 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1165518783 19:36302451-36302473 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1165519331 19:36304981-36305003 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1165519880 19:36307496-36307518 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1165593088 19:36987834-36987856 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1165629044 19:37293837-37293859 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1165720822 19:38078419-38078441 GTGCATGTATGCGCATGTGTAGG - Intronic
1165922247 19:39306726-39306748 GTGTGTGTGTGTGTGTGTTGGGG - Exonic
1166222915 19:41377047-41377069 GTACGTGTATGTGTGTGCTGGGG + Intronic
1166346521 19:42169754-42169776 GTGCGTGTGTGTGTGTGTCGGGG + Intronic
1167014285 19:46830191-46830213 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1167112902 19:47472190-47472212 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1167574658 19:50312306-50312328 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1168059201 19:53882066-53882088 GTGGGTGTGTGCACGTGTGGGGG + Intronic
1168227246 19:55004593-55004615 GTGTGTGTGTGTGCGCGTTGGGG - Intergenic
1168317010 19:55488898-55488920 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
925059177 2:878030-878052 GTGCGTGTGTGTGTGTGTAGGGG - Intergenic
925319678 2:2952454-2952476 GTGTGTGCATGTGCGTGTTGGGG - Intergenic
925779648 2:7370367-7370389 GTGTGTGTATGTGTGTGTTATGG - Intergenic
926122495 2:10252429-10252451 GTGTGTGCATGTGCGTGTGGTGG + Intergenic
927684934 2:25163974-25163996 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
927800259 2:26092305-26092327 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
928171982 2:29010039-29010061 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
928281079 2:29946946-29946968 GTGTGTGTGTGTGTGTGTTGAGG + Intergenic
928326440 2:30323079-30323101 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
928586344 2:32762311-32762333 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
928611211 2:32993992-32994014 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
928667752 2:33567560-33567582 GTGTGTGTATGTGTGTTTTGAGG - Intergenic
928689193 2:33781600-33781622 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
928729631 2:34216178-34216200 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
928791676 2:34964171-34964193 GTGCATGTGTGTGTGTGTTGAGG + Intergenic
929414044 2:41729520-41729542 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
929774511 2:44920371-44920393 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
929774517 2:44920411-44920433 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
929878557 2:45817093-45817115 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
930004923 2:46889041-46889063 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
930400378 2:50877168-50877190 GTGTGTCTATGTGTGTGTTGGGG - Intronic
930920176 2:56743694-56743716 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
931262592 2:60633068-60633090 GTGCGTGCATGCACGTATTTGGG + Intergenic
931355906 2:61537748-61537770 GTGTGTGTGTGTGTGTGTTGGGG - Exonic
931463624 2:62468565-62468587 GTGGGTGCATGTGGGTGTTGGGG + Intergenic
931763759 2:65436925-65436947 TTGGGTGTGTGCGCGCGTTGGGG + Intergenic
931877264 2:66527624-66527646 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
931969443 2:67569359-67569381 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
931991666 2:67796681-67796703 GTGTGTGTATGTGCGTGATGGGG - Intergenic
932129626 2:69176080-69176102 GTGTGTGTATGTGTGTGTGGGGG - Intronic
932766871 2:74476040-74476062 GTGTGTGTGTGTGTGTGTTGCGG - Intronic
933214623 2:79615824-79615846 GTGTTTGTATGTGCGTGTTGGGG + Intronic
933308556 2:80632273-80632295 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
933704949 2:85282826-85282848 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
933757521 2:85651590-85651612 GTGCGTGTGTGTGTGTGTGGTGG + Intergenic
933978203 2:87528792-87528814 GTGCCTGTATGCACGTGGGGTGG + Intergenic
934032525 2:88061161-88061183 GTGTGTGTATGTGTGTGTTGGGG + Intergenic
934032531 2:88061199-88061221 GTGTGTGTATGTGTGTGTTGGGG + Intergenic
935390566 2:102548086-102548108 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
935467873 2:103420851-103420873 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
935528059 2:104197171-104197193 GTGCGTGTGTGCGTGTCCTGGGG + Intergenic
935962498 2:108440677-108440699 GTGTGTGTATGTGTGTGTGGGGG - Intergenic
936315631 2:111422009-111422031 GTGCCTGTATGCACGTGGGGTGG - Intergenic
936899803 2:117469936-117469958 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
937147293 2:119658610-119658632 GTGTGTGTGTGTGCGTGTTGAGG - Intronic
937260834 2:120586079-120586101 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
937501973 2:122489097-122489119 GTGTGTGTGTGTGTGTGTTGAGG + Intergenic
937634346 2:124139259-124139281 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
938278343 2:130047892-130047914 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
938329316 2:130438697-130438719 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
938437033 2:131289494-131289516 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
938784472 2:134612538-134612560 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
939046862 2:137259931-137259953 GTGCGTGTGTGTGTGTGTGGTGG + Intronic
939127520 2:138195075-138195097 GTGCATGTGTGTGTGTGTTGGGG - Intergenic
939156865 2:138536343-138536365 GTGCGTGTGTGTGTGTGTGGGGG - Intronic
939159294 2:138567417-138567439 GTGTGTGTGTGTGTGTGTTGCGG + Intronic
939704263 2:145432463-145432485 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
939993029 2:148894015-148894037 GTGTGTGTATGTGTGTGTGGTGG - Intronic
940051326 2:149468128-149468150 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
940732875 2:157414559-157414581 GTGCGTGTGTGTGTGTGTTTGGG - Intergenic
941298591 2:163772532-163772554 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
942264728 2:174211176-174211198 GTGTGTGTGTGTGTGTGTTGTGG - Intronic
942425128 2:175852091-175852113 GGGTGTGTATGCGCGTGTGTAGG - Intergenic
942874466 2:180777620-180777642 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
942885546 2:180919352-180919374 GTGTGTGTATGTGTGTGTTTTGG - Intergenic
943537530 2:189171125-189171147 GTGTGTGTCTGTGTGTGTTGGGG + Intronic
944027517 2:195189520-195189542 GTGTGTGTATGTCCCTGTTGTGG + Intergenic
944193067 2:197023949-197023971 ATGTGTGTATGAGCGTGTAGTGG + Intronic
944348232 2:198694707-198694729 GTGTGTGTGTGTGTGTGTTGAGG - Intergenic
945414714 2:209556612-209556634 GTGCGTGTATGCAAGGGTGGAGG - Intronic
945712124 2:213310315-213310337 GTGTGTGTGTGTGTGTGTTGTGG - Intronic
945877360 2:215292458-215292480 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
946925927 2:224626819-224626841 GTGTGTGTCTGTGTGTGTTGGGG - Intergenic
947077383 2:226360097-226360119 GTGTGTGTATGTGTGTATTGGGG - Intergenic
947110615 2:226715452-226715474 GTGTGTGTGTGTGCGTGTGGTGG + Intergenic
947110617 2:226715454-226715476 GTGTGTGTGTGCGTGTGGTGGGG + Intergenic
947110650 2:226715694-226715716 GTGTGTGTGTGCGTGTGGTGGGG + Intergenic
947395638 2:229684194-229684216 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
947958970 2:234218678-234218700 GCGCGTGTGCGCGCGTGTTTGGG + Intergenic
948226302 2:236311720-236311742 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
948563834 2:238871098-238871120 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
948637103 2:239345588-239345610 GTGTGTGTATGTGTGTGTTAGGG - Intronic
948743250 2:240062897-240062919 GTGCGTGCATGTGTGTGTGGTGG + Intergenic
949029556 2:241786153-241786175 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1169081498 20:2800304-2800326 GTGCGTGTGCCCGCGTGTTAGGG + Intronic
1169253391 20:4078067-4078089 GTGCTTGTTTGCGGTTGTTGAGG + Intergenic
1169526652 20:6435168-6435190 GTGCGTGGATGGGTGTGGTGGGG + Intergenic
1169580516 20:7018044-7018066 GTGTGTGTATGCATGTGTTTTGG + Intergenic
1170784053 20:19452408-19452430 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1170830643 20:19837165-19837187 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1172135397 20:32683241-32683263 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1172195322 20:33087713-33087735 GTGTGTGTGTGTGTGTGTTGAGG - Intronic
1172594769 20:36143165-36143187 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1172715846 20:36962935-36962957 TTGTGTGTATGCGGGTGGTGGGG + Intergenic
1172876210 20:38165667-38165689 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1173484633 20:43431430-43431452 GTGTGTGTTTGTGCGTGTTTTGG - Intergenic
1173539630 20:43841688-43841710 GTGCATGTATGCGTGTGTTGAGG - Intergenic
1174179881 20:48668159-48668181 GTGCGTGCATGCGCATGTGCAGG + Intronic
1174482019 20:50837965-50837987 GTGCGTGTGTGTGTGTGTAGAGG - Intronic
1174561489 20:51433771-51433793 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1174968884 20:55251375-55251397 GTGCGTGCATGTGCGTGTGTGGG - Intergenic
1175599201 20:60259009-60259031 GTGTGTGTGTGTGTGTGTTGCGG + Intergenic
1175814385 20:61875933-61875955 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1175876018 20:62230398-62230420 GTGTGTGTATGGGTGTGTTGAGG - Intergenic
1175948725 20:62571186-62571208 GTGCGTTTATGTGTGTGTGGAGG - Intergenic
1178224694 21:30701790-30701812 GTGTGTGTGTGTGTGTGTTGAGG + Intergenic
1180801056 22:18632175-18632197 GTGCATGTGTGCATGTGTTGGGG - Intergenic
1180852288 22:19027732-19027754 GTGCATGTGTGCATGTGTTGGGG - Intergenic
1181220663 22:21363086-21363108 GTGCATGTGTGCATGTGTTGGGG + Intergenic
1181610870 22:24011072-24011094 GTGTGTGTGTGTGTGTGTTGCGG - Intergenic
1181788787 22:25246976-25246998 ATGCGTGTATGCGAGTGTATGGG - Intergenic
1181911262 22:26240041-26240063 ATGTGTGTATGTGTGTGTTGAGG - Intronic
1182012661 22:27013741-27013763 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1182149932 22:28020774-28020796 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1182221228 22:28760531-28760553 GTGCCTGTGTGTGTGTGTTGGGG - Intergenic
1182381617 22:29894520-29894542 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1182723488 22:32423590-32423612 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1182815558 22:33160264-33160286 GTGTGTGTATGTGTATGTTGAGG + Intergenic
1183265341 22:36821519-36821541 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1184035911 22:41917978-41918000 GCGGGTGTCTGCGCGTGTTTGGG + Intergenic
1184400210 22:44269463-44269485 GTGTGTGTGTGCGCGTGTTGTGG - Intronic
1184707714 22:46225836-46225858 GTGTGTGTGTGCGTGTGTGGGGG - Intronic
1184796259 22:46735072-46735094 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1184914944 22:47562951-47562973 GTGTGTGTATGTGTGTGTAGGGG + Intergenic
949141858 3:643629-643651 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
949265202 3:2148954-2148976 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
949382075 3:3457695-3457717 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
949751698 3:7359238-7359260 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
949980858 3:9500936-9500958 GTGTGTGTGTGTGTGTGTTGGGG - Exonic
951014988 3:17721471-17721493 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
951118125 3:18889682-18889704 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
951218185 3:20043351-20043373 GTGTGTGTATGCATGTGTTGGGG + Intronic
951264032 3:20546851-20546873 GTGTGTGTATGTGAGTGTTTAGG + Intergenic
951465542 3:22997167-22997189 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
951685376 3:25338092-25338114 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
951774774 3:26297647-26297669 ATGCGTGTGTGTGTGTGTTGTGG - Intergenic
952056288 3:29450888-29450910 GTGTGTGTATCTGTGTGTTGAGG - Intronic
952907941 3:38155583-38155605 GTGCCTGTGTGTGTGTGTTGGGG + Intergenic
952981052 3:38736389-38736411 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
953384811 3:42500515-42500537 GTGTGTGTATGTATGTGTTGAGG + Intronic
953412878 3:42700008-42700030 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
953412895 3:42700174-42700196 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
953631291 3:44620362-44620384 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
953740626 3:45535767-45535789 GTGTGTGTATGTGGGTGTGGGGG - Intronic
953748864 3:45594774-45594796 GTGTGTGTGTGTGTGTGTTGAGG - Intronic
954590345 3:51777370-51777392 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
955012048 3:55026972-55026994 GTGCGTGCATGCGCGCTTAGCGG - Intronic
955327422 3:58020079-58020101 GTGTGTGTGTGTGTGTGTTGAGG + Intronic
955663260 3:61323981-61324003 GTGTGTGTGTGCGCGCGTTGGGG + Intergenic
955826997 3:62958064-62958086 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
955880631 3:63540926-63540948 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
956542631 3:70359043-70359065 GTGAGTGTATATGTGTGTTGGGG - Intergenic
956739784 3:72266815-72266837 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
957747946 3:84368947-84368969 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
957853558 3:85843880-85843902 GTGAGTGTATGTGTGTGTGGGGG + Intronic
958166143 3:89880290-89880312 GTGTGTGTGTGCGTGTGCTGTGG + Intergenic
959679149 3:109072930-109072952 GTGTGTGTGTGTGTGTGTTGAGG - Intronic
959837061 3:110931611-110931633 ATGTGTGTATGTGTGTGTTGGGG - Intergenic
960034299 3:113087042-113087064 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
960187769 3:114664600-114664622 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
960334310 3:116397392-116397414 GTGTGTGTATGTGTGTGTGGGGG - Intronic
960340161 3:116465129-116465151 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
960458586 3:117904106-117904128 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
960521987 3:118665542-118665564 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
961080310 3:124021319-124021341 GTGTGTGTGTGTGTGTGTTGAGG + Intergenic
961385913 3:126523549-126523571 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
961792779 3:129388508-129388530 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
961868350 3:129970901-129970923 GTGTGTGTATGTGTGTATTGTGG + Intergenic
962216910 3:133530524-133530546 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
962318328 3:134372526-134372548 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
962590243 3:136882573-136882595 GTGTGTGTGTGTGTGTGTTGAGG + Intronic
962648711 3:137466482-137466504 GTGTGTGTGTGCGCGTGTGTTGG + Intergenic
962690386 3:137890944-137890966 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
962847214 3:139283152-139283174 GTGTGTGTGTGTGTGTGTTGAGG - Intronic
962867866 3:139462554-139462576 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
963116495 3:141734693-141734715 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
963322873 3:143828560-143828582 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
964033659 3:152169062-152169084 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
964527743 3:157632969-157632991 GTGTGTGTATGTGTGTGGTGGGG - Intronic
964663784 3:159150579-159150601 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
965109530 3:164402571-164402593 GTGTGTGTCTGTGTGTGTTGGGG + Intergenic
966912560 3:184567497-184567519 GTGTGTGTGTGTGTGTGTTGCGG + Intronic
966928204 3:184659171-184659193 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
967415269 3:189210115-189210137 GTGTGTGTCTGTGTGTGTTGGGG + Intronic
967479786 3:189959896-189959918 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
968959330 4:3734975-3734997 GTGTGTGAAGGCGCGTGGTGTGG + Intergenic
969076167 4:4579382-4579404 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
969239914 4:5891161-5891183 GTGTGTGTATGTGTGTGTGGTGG - Intronic
969437257 4:7195180-7195202 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
970064473 4:12076162-12076184 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
970192599 4:13530057-13530079 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
970712962 4:18885739-18885761 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
970873821 4:20846649-20846671 GTGCGCGTATGTGTGTGTAGGGG - Intronic
971077323 4:23164940-23164962 GTGCGTGTGTGCATGTGTGGTGG - Intergenic
971670714 4:29553206-29553228 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
971809569 4:31406810-31406832 GTGTGTGTCCGCGCGCGTTGGGG - Intergenic
972113306 4:35593808-35593830 GTGCGTTTATGTGTGTGTTGGGG + Intergenic
972562703 4:40242979-40243001 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
972873481 4:43329215-43329237 GTTTGTGTATGTGTGTGTTGGGG + Intergenic
972883611 4:43457204-43457226 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
973115775 4:46456625-46456647 GTGTGTGTATGTGTGTGTGGTGG - Intronic
974571145 4:63650295-63650317 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
974598547 4:64045287-64045309 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
974716356 4:65672405-65672427 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
975601784 4:76107943-76107965 GTGTGTGCATGTGTGTGTTGGGG + Intronic
975783283 4:77862004-77862026 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
975930377 4:79514468-79514490 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
975986906 4:80208536-80208558 GTGTGTGTGTGTGTGTGTTGCGG - Intergenic
977236310 4:94511594-94511616 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
977435919 4:96994158-96994180 GTGCGTGTGTGTGTGTGTTCAGG + Intergenic
977665583 4:99643735-99643757 GTGTGTGTGTGTGTGTGTTGTGG - Intronic
977912293 4:102551380-102551402 GTGTGTGTGTGTGTGTGTTGAGG + Intronic
978050080 4:104188046-104188068 GTGGGTGTGTGTGTGTGTTGTGG + Intergenic
978360194 4:107923472-107923494 GTGTGTGTATGTGTGTGTAGGGG - Intergenic
978993516 4:115118969-115118991 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
979288900 4:118958264-118958286 GTGCGTGTATGTTGGGGTTGGGG + Intronic
979366864 4:119835905-119835927 GTGTGTGTGTGTGTGTGTTGAGG - Intergenic
979416825 4:120451785-120451807 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
979615109 4:122733372-122733394 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
979755713 4:124338219-124338241 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
980491860 4:133538504-133538526 GTGTGTGTATGTGTGTGTTTAGG + Intergenic
980739841 4:136935829-136935851 GTGTGTGTATGCGTGTGGAGGGG - Intergenic
982037553 4:151361414-151361436 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
982291869 4:153789534-153789556 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
982493833 4:156065172-156065194 GTGTGTGTATGTGTGTGTTGGGG + Intergenic
982705122 4:158700553-158700575 GTGCGTGTGTGTGTGTGTGGTGG - Intronic
982926529 4:161343854-161343876 GTGCATGTTTGTGTGTGTTGGGG + Intergenic
984136642 4:175948977-175948999 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
984538713 4:181010443-181010465 GTGTGTGTGTGTGTGTGTTGAGG - Intergenic
984603853 4:181760955-181760977 GTGTGTGTATGTGTGTGGTGGGG - Intergenic
984782403 4:183537874-183537896 GTGTGTGTGTGTGTGTGTTGAGG + Intergenic
985660431 5:1154350-1154372 GTGTGTGTGTGTGTGTGTTGCGG - Intergenic
986189597 5:5482771-5482793 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
986806174 5:11310957-11310979 GTGTGTGTATGTGTGGGTTGAGG - Intronic
986994534 5:13592061-13592083 GTGTGTGTGTGTGTGTGTTGCGG - Intergenic
987335642 5:16895749-16895771 GTGTGTGTGTGTGTGTGTTGTGG - Intronic
987841673 5:23230669-23230691 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
988565232 5:32315404-32315426 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
989292047 5:39779282-39779304 GTGCGTGTGTGTGCGTGTGTTGG - Intergenic
989456997 5:41655469-41655491 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
990016658 5:51071658-51071680 GTGTGTGTGTGTGTGTGTTGAGG + Intergenic
990254107 5:53947204-53947226 GTGTGTGTGTGTGTGTGTTGAGG + Intronic
990622141 5:57571308-57571330 GTGTGTGTATGCGGGGGGTGGGG + Intergenic
991335752 5:65545313-65545335 GTGTGTGTGTGCGCGCTTTGAGG - Intronic
991459618 5:66844181-66844203 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
992773683 5:80071641-80071663 GTGTGTGTATGTGTGTGTTGGGG - Intronic
993206267 5:84883486-84883508 GTGTATGTATGTGTGTGTTGGGG + Intergenic
993605662 5:89987887-89987909 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
994260868 5:97657000-97657022 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
994314807 5:98320480-98320502 GTGTGTGTGTGCGTGTGGTGTGG - Intergenic
994690347 5:103011341-103011363 GTGTGTGTATGTGTGTGTGGCGG - Intronic
994709081 5:103244138-103244160 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
995389013 5:111618582-111618604 GTGCGTGTGTGTGTGTGTTTTGG - Intergenic
995914783 5:117231694-117231716 GTGTGTGTGTGCATGTGTTGGGG + Intergenic
996145861 5:119975306-119975328 GTGTGTGTATGTGTGTGGTGTGG + Intergenic
996200936 5:120672264-120672286 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
996519413 5:124410242-124410264 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
996851756 5:127960796-127960818 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
997485271 5:134225913-134225935 GTGCGTGTAGGCCCGTGTGCGGG - Exonic
997509702 5:134445645-134445667 GTGCGTGTGTGTGTGTGATGGGG + Intergenic
997639737 5:135441426-135441448 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
997652587 5:135533612-135533634 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
997869830 5:137497843-137497865 GTGTGTGTGTGTGTGTGTTGAGG - Intronic
998415347 5:141941952-141941974 GTGCGTGTGTGCGTGTGTATAGG - Exonic
998559971 5:143162270-143162292 GTGTGTGTATGTGTGTGTTTGGG - Intronic
998597033 5:143542495-143542517 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
999254704 5:150203847-150203869 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
999298787 5:150477461-150477483 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
999745317 5:154587481-154587503 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1000116030 5:158154175-158154197 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1000346144 5:160315314-160315336 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1001001646 5:168013099-168013121 GTGTGTGTAAGTGTGTGTTGGGG - Intronic
1001022530 5:168195594-168195616 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1001118862 5:168962307-168962329 GTGTGTGTGTGTGTGTGTTGTGG - Intronic
1001245734 5:170104940-170104962 GTGCGTGTATGTGTGTGTTGGGG + Intergenic
1001774194 5:174316367-174316389 GTGTGTGTATGTGTGTGTGGTGG + Intergenic
1002668018 5:180840805-180840827 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1002775286 6:323246-323268 GTGTGTGTGTGTGTGTGTTGAGG + Intronic
1003030766 6:2598748-2598770 GTGTGTGTGTGCGCGCGCTGGGG + Intergenic
1003035487 6:2637533-2637555 GTGTGTGTGTGCGCGTGCGGGGG + Intergenic
1003114690 6:3276111-3276133 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1003286222 6:4735887-4735909 GTGCATGTGTGCACGTGATGGGG + Intronic
1003313095 6:4986412-4986434 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1003840613 6:10115349-10115371 GTGTGTGTTTGTGTGTGTTGTGG - Intronic
1003874434 6:10423617-10423639 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1004180108 6:13373737-13373759 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1004294014 6:14394006-14394028 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1004673700 6:17821571-17821593 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1004679094 6:17874974-17874996 GTGCGTGTGTGTGTGTGTGGTGG - Intronic
1004845737 6:19639725-19639747 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1004974924 6:20954436-20954458 GTGCCTGTGTGTGTGTGTTGAGG + Intronic
1005181894 6:23115650-23115672 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1005199254 6:23324705-23324727 GTGTGTGTATGTGTGTGTTGGGG - Intergenic
1005282106 6:24285035-24285057 GTGCATGTATGTGTGTGTGGGGG - Intronic
1005942621 6:30571924-30571946 GTGTGTGTATGCGCGCGCAGGGG - Intronic
1006110076 6:31739107-31739129 GTGTGTGTGTGTGTGTGTTGCGG - Intronic
1006208667 6:32374268-32374290 GTGTGTGTGTGTGTGTGTTGAGG + Intergenic
1006517942 6:34555039-34555061 GTGCGTGTGTGTGCATGTTGGGG - Intronic
1006597279 6:35202674-35202696 GTGTGTGTGTGTACGTGTTGGGG + Intergenic
1006629025 6:35418179-35418201 GTGAGCATATGCTCGTGTTGGGG - Intronic
1006814333 6:36840120-36840142 GTGTGTGTGTGCGCGCGTGGCGG + Intergenic
1006921967 6:37633178-37633200 GTGTGTGTGTGTGTGTGTTGGGG - Exonic
1007384260 6:41510047-41510069 GTGTGTGTACGTGTGTGTTGGGG - Intergenic
1007490351 6:42216396-42216418 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1007609886 6:43142503-43142525 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1007698019 6:43746231-43746253 GTGCGTGTGTGTGTGTGTGGAGG + Intergenic
1007786223 6:44281057-44281079 GTGCGTGTATGTGCCTGTGTAGG + Intronic
1008725601 6:54414589-54414611 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1008892809 6:56514612-56514634 GTGTGTGTATGCGCATGAGGGGG - Intronic
1009668462 6:66713219-66713241 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1010016684 6:71112275-71112297 GTGTGTGTGTGTGCGTGTAGTGG - Intergenic
1010116117 6:72314068-72314090 GTGTGTGTATGTGGGTGTAGTGG + Intronic
1010279321 6:74005678-74005700 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
1010318808 6:74482941-74482963 GGGAGTGCATGCGTGTGTTGCGG - Intergenic
1010411172 6:75563345-75563367 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1011021626 6:82819936-82819958 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1011499987 6:87977423-87977445 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1012209865 6:96506413-96506435 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1012687395 6:102268952-102268974 GTGTGTGTGTGTGTGTGTTGAGG - Intergenic
1012700858 6:102455182-102455204 GTGTGTGTATGTGTGTGTTTAGG + Intergenic
1013607980 6:111768125-111768147 ATGCGTGTATGTGGTTGTTGGGG + Intronic
1013745441 6:113339918-113339940 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1015901255 6:138070147-138070169 GTGCGTGTGTGTGTGTGTAGGGG + Intergenic
1016025754 6:139285253-139285275 GTGTGTGTGTGTGTGTGTTGAGG - Intronic
1016308015 6:142703481-142703503 GTGCGTGCGCGCGCATGTTGCGG - Intergenic
1016688143 6:146904476-146904498 GTGTGTGTGTGTGTGTGTTGAGG + Intergenic
1016778488 6:147932622-147932644 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1016801762 6:148175972-148175994 GTGCGTGTGTGCACGTGCTTGGG - Intergenic
1017439606 6:154451462-154451484 GTGTGTGTGTGCGCGTTTGGTGG - Intronic
1017562389 6:155642807-155642829 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1017878596 6:158544201-158544223 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1017918685 6:158853311-158853333 GTGCGTGTATGTGTGTGGTATGG - Intergenic
1018773310 6:166991477-166991499 GTGTGTGTATGAGGGTGTTTTGG + Intergenic
1018776516 6:167022255-167022277 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1019125950 6:169840194-169840216 GGGCGTGGGTGGGCGTGTTGTGG - Intergenic
1019755132 7:2763187-2763209 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1020014476 7:4822903-4822925 GTGCGTGTATGCGTGCATGGGGG + Intronic
1020968522 7:14903237-14903259 GTGTGTGTGTGTGTGTGTTGAGG + Exonic
1020969607 7:14919053-14919075 GTGTGTGTGTGTGCGTGTGGTGG - Intronic
1021085187 7:16414346-16414368 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1021293028 7:18869170-18869192 GTGTGTGTGTGTGTGTGTTGCGG + Intronic
1021905159 7:25326257-25326279 GTGTGTGTGTGTGTGTGTTGAGG + Intergenic
1022234474 7:28447635-28447657 GTGTGTGTATGTGTGTATTGTGG + Intronic
1022518721 7:30992140-30992162 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1022560230 7:31340361-31340383 GTGTGTATATGTGTGTGTTGAGG - Intronic
1022887654 7:34663075-34663097 GTGTGTGTATGTGTGTGTGGCGG + Intronic
1022977721 7:35574521-35574543 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1023847221 7:44129211-44129233 GTGTGTGTATGTGCATGTGGGGG - Intergenic
1024316695 7:48026577-48026599 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1024524843 7:50339241-50339263 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1024602676 7:50998334-50998356 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1024689281 7:51781600-51781622 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1024752622 7:52486214-52486236 GTGTGTGTGTGCGTGTGTAGAGG - Intergenic
1026401014 7:70012940-70012962 GTGCATGTATGTGTGTTTTGGGG + Intronic
1026508612 7:71008358-71008380 GTGCGTGCGTGCGTGTGTTAGGG + Intergenic
1027138324 7:75639621-75639643 GTGCATGCATGCGTGTGTTTTGG + Intronic
1027164712 7:75826136-75826158 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1027861795 7:83593318-83593340 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1027916606 7:84331798-84331820 GTGCGTGCATGCTCCTTTTGTGG + Intronic
1028487930 7:91380289-91380311 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1028649120 7:93130687-93130709 GTGTGTGTGTGTGTGTGTTGGGG + Exonic
1029231881 7:99076885-99076907 GCACGTGTGTGCGCGTGTGGGGG + Intronic
1029696453 7:102216630-102216652 GTGTGTGTGTGCGTGTGTGGGGG - Intronic
1030071573 7:105702541-105702563 GTGTGTGTGTGTGTGTGTTGTGG - Intronic
1030275775 7:107720107-107720129 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1030375714 7:108751067-108751089 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1030395472 7:108981030-108981052 GTGTGTGTATGTGTGTGTAGTGG - Intergenic
1030927274 7:115474492-115474514 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1031011291 7:116526793-116526815 GTGTGTGTGTGCGCGTGTAGGGG - Intronic
1031155979 7:118112884-118112906 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1031911026 7:127516767-127516789 GTGCGTGTGTGTGTCTGTTGGGG - Intergenic
1031925602 7:127635323-127635345 GTGTGTGTGTGTGTGTGTTGAGG + Intergenic
1032023366 7:128422163-128422185 GTGTGTGTATGTGTGTGGTGTGG + Intergenic
1032566841 7:132955198-132955220 GTGTGTGTGTGTGTGTGTTGCGG + Intronic
1032960079 7:137022225-137022247 GTGTGTGTATGTGTGTGTTAAGG - Intergenic
1033491562 7:141848479-141848501 GTGTGTGTGTGTGTGTGTTGCGG + Intergenic
1033571201 7:142630449-142630471 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1034013126 7:147552567-147552589 GTGTGTGTGTGTGTGTGTTGAGG - Intronic
1034418922 7:150978887-150978909 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1034455185 7:151166483-151166505 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1034869547 7:154671849-154671871 GTGTGTGCATGTGTGTGTTGGGG - Intronic
1034977488 7:155456961-155456983 GTGCGTGTGTGTGCGTGTGCAGG - Intergenic
1034984882 7:155504685-155504707 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1035368733 7:158364966-158364988 GTGTGTGAATGTGTGTGTTGTGG - Intronic
1035732676 8:1863837-1863859 GCGCGTGTATTTGCGTGTGGAGG + Intronic
1035877397 8:3206348-3206370 GTGTGTGTATGTGTGTATTGGGG + Intronic
1035877402 8:3206381-3206403 GTGTGTGTATGTGTGTGTGGGGG + Intronic
1035877409 8:3206443-3206465 GTGTGTGTATGTGTGTGTGGGGG + Intronic
1036018440 8:4814242-4814264 GTGTGTGTATGTGTGTGGTGGGG + Intronic
1036786925 8:11693931-11693953 GTGCATGTGTGTGTGTGTTGAGG + Intronic
1037405172 8:18534798-18534820 GTGCGTGTGTGTGCGTGTGTGGG - Exonic
1037431841 8:18821680-18821702 GTGTGTGTGTGTGTGTGTTGTGG - Intronic
1037590125 8:20304911-20304933 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1037658959 8:20910955-20910977 GTGAGTGTATGTGTGTGTTTGGG - Intergenic
1037769878 8:21792218-21792240 GCGCATGTGTGCGTGTGTTGGGG - Intronic
1038557124 8:28530125-28530147 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1038908416 8:31934382-31934404 GTGTGTGTATGTGTGTGTAGGGG - Intronic
1039456522 8:37711005-37711027 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1039466466 8:37788513-37788535 ATGCGTGCATGCACGTGTTGGGG - Intronic
1039466477 8:37788589-37788611 GTGCGTGCATGCACATGTTGGGG - Intronic
1039557743 8:38488730-38488752 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1039829682 8:41202838-41202860 GTGTGTGTATGTGTGTGTTTTGG - Intergenic
1040534811 8:48299543-48299565 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1041015881 8:53592876-53592898 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1041261515 8:56024621-56024643 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1042334576 8:67616535-67616557 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1042456678 8:69013543-69013565 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1042702644 8:71633447-71633469 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1042722746 8:71843027-71843049 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1043157319 8:76800064-76800086 GTGAGTGTGTGTGTGTGTTGTGG + Intronic
1044390504 8:91644951-91644973 GTGTGTGTGTGCGTGTGTGGCGG + Intergenic
1044466666 8:92514446-92514468 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
1044757482 8:95480111-95480133 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1045352903 8:101358821-101358843 GTGTGTGTATTTGTGTGTTGGGG - Intergenic
1045538648 8:103059869-103059891 GTGTGTGTGTGTGCGTGCTGGGG - Intronic
1045768898 8:105710695-105710717 GTGTGTGTATGTGTGTGTGGGGG + Intronic
1046717984 8:117587903-117587925 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1046993868 8:120493460-120493482 GTGTGTGTATGTGTGTGTGGGGG + Intronic
1047118788 8:121876575-121876597 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1047148987 8:122239823-122239845 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1047158620 8:122350937-122350959 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1047364981 8:124203462-124203484 GTGGGTGTGTGTGTGTGTTGGGG - Intergenic
1047468504 8:125143812-125143834 GTGTGTGTATGTGTGTGTTAGGG - Intronic
1048045430 8:130768251-130768273 ATGCGTGTGTGTGTGTGTTGGGG + Intergenic
1048060830 8:130917775-130917797 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1048254127 8:132892655-132892677 GTGTGTGTATGTGTGTGCTGTGG + Intronic
1048254142 8:132892825-132892847 GTGTGTGTATGTGTGTGGTGTGG + Intronic
1048293012 8:133194643-133194665 GTGCGTGTGTGCGTGTGTGGTGG + Intronic
1048501762 8:134983006-134983028 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1048531845 8:135257001-135257023 GTGTGTGTTTGTGTGTGTTGGGG + Intergenic
1048654227 8:136517716-136517738 GTGTGTGTATTGGGGTGTTGGGG - Intergenic
1048697665 8:137046734-137046756 GTGTGTGTGTGCGCGTGTGCTGG + Intergenic
1048865394 8:138757310-138757332 GTGTGTGTATGTGTGTGTGGAGG + Intronic
1049525404 8:143123260-143123282 GTGCATGTATGCACGTGTGAGGG - Intergenic
1049754961 8:144306921-144306943 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1050072181 9:1826947-1826969 GTGCATGTGTGTGTGTGTTGGGG - Intergenic
1050206029 9:3197107-3197129 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
1051550030 9:18317389-18317411 GTGTGTGTGTGTGTGTGTTGAGG - Intergenic
1051779934 9:20679155-20679177 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1052394934 9:27927523-27927545 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
1052554855 9:30000599-30000621 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1052883520 9:33621611-33621633 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1052953264 9:34231159-34231181 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1053307437 9:36994484-36994506 GTGCGTGTATGTGTGTGGTCAGG - Intronic
1053875097 9:42536357-42536379 GTGTGTGTATGTGTGTGTGGAGG - Intergenic
1054236600 9:62565362-62565384 GTGTGTGTATGTGTGTGTGGAGG + Intergenic
1055116813 9:72613744-72613766 TTGTGTGTGTGTGCGTGTTGTGG + Intronic
1055128923 9:72752443-72752465 GTGTGTGTGTGTGTGTGTTGTGG - Intronic
1055134723 9:72814930-72814952 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1055715662 9:79115239-79115261 TTGTGTGTCTGCGTGTGTTGGGG - Intergenic
1055801624 9:80042908-80042930 GTGTGTGTGTGTGCGTGTAGGGG - Intergenic
1056541010 9:87571432-87571454 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1056541014 9:87571494-87571516 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1056950578 9:91037660-91037682 GTGCATGTATGTGTGCGTTGGGG - Intergenic
1057714855 9:97484465-97484487 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1057819310 9:98318897-98318919 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1057930976 9:99192737-99192759 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1057950819 9:99367957-99367979 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1058375194 9:104314811-104314833 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1059280946 9:113133559-113133581 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1059415065 9:114157071-114157093 GTGTGTGTGTGTGTGTGTTGTGG - Intronic
1060084805 9:120688126-120688148 GTGTGTGTGTGTGTGTGTTGCGG - Intronic
1060203435 9:121666863-121666885 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1061005186 9:127924869-127924891 GTGCGTGTGTGTGTGTGTAGAGG - Intronic
1061247447 9:129407989-129408011 GTGTGTGTGTGTGTGTGTTGAGG - Intergenic
1061498791 9:130990617-130990639 GCGTGTGTGTGCGTGTGTTGTGG - Intergenic
1061904806 9:133691165-133691187 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1062021312 9:134320699-134320721 GTGCGTGTGTGTGTGTGTTGGGG + Intronic
1062344266 9:136107610-136107632 GTGCACGTATGTGCGTGTGGGGG - Intergenic
1186084169 X:5968491-5968513 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1186349949 X:8731234-8731256 GTGCGTGTATGCGCGTGTTGGGG - Intronic
1187291550 X:17959073-17959095 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1187308922 X:18122241-18122263 GTGTGTGTATGTGTGTGTTGAGG - Intergenic
1187955067 X:24509485-24509507 GTATGTGTATGTGTGTGTTGGGG - Intronic
1188003319 X:25001907-25001929 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1188231791 X:27673042-27673064 GTGTGTGTATGTGTGTGGTGGGG - Intronic
1188581860 X:31723619-31723641 GTGTGTGTGTGTGTGTGTTGTGG - Intronic
1189090279 X:38074901-38074923 GTGTGTGTGTGTGTGTGTTGAGG - Intronic
1189132495 X:38514753-38514775 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1189309549 X:40009855-40009877 GTGCCTGTGTGTGTGTGTTGGGG - Intergenic
1189549230 X:42076029-42076051 GTGTGTGTATGTGTGTGTGGGGG + Intergenic
1189645272 X:43121554-43121576 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1189761351 X:44324553-44324575 GTGTGTGTATGCAGGGGTTGGGG - Intronic
1190222354 X:48520593-48520615 GTGTGTGTGTGTGTGTGTTGAGG - Exonic
1190339120 X:49282477-49282499 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1190415300 X:50174762-50174784 GAGCGTGTGAGCGTGTGTTGAGG + Intergenic
1191054459 X:56227870-56227892 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1191058582 X:56270343-56270365 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1191717129 X:64201444-64201466 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1191999171 X:67129602-67129624 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1192157805 X:68759339-68759361 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1192238004 X:69308146-69308168 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1192262735 X:69516802-69516824 GTGCGTTTGTGTGTGTGTTGAGG + Intronic
1193080367 X:77400397-77400419 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1193150799 X:78122435-78122457 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1193208232 X:78774142-78774164 GTGTGTGTGTGCGCGTGTGTTGG - Intergenic
1194277691 X:91907366-91907388 GTGTGTGTGTGTGTGTGTTGAGG - Intronic
1194598695 X:95892557-95892579 GTGTGTGTATGTGTGTGTTGGGG + Intergenic
1195045974 X:101054895-101054917 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1195133421 X:101877693-101877715 GTGTGTGTGTGTGTGTGTTGAGG - Intergenic
1195273728 X:103257808-103257830 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1195603839 X:106779373-106779395 GTGTGTGTGTGTGTGTGTTGAGG + Intronic
1195660727 X:107375246-107375268 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1196322874 X:114363414-114363436 GTGTGTGTCTGTGTGTGTTGTGG + Intergenic
1196618013 X:117789835-117789857 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1196831400 X:119778598-119778620 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
1197329820 X:125139819-125139841 GTGTGTGTGTGTGTGTGTTGAGG - Intergenic
1197630079 X:128848338-128848360 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1197845345 X:130795985-130796007 GTGTGTGTATGTGTGTGTTCTGG + Intronic
1198080829 X:133237670-133237692 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1198130225 X:133686764-133686786 GTGTGTGTGTGTGTGTGTTGAGG - Intronic
1198217544 X:134569792-134569814 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1198285221 X:135183138-135183160 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1198464956 X:136896780-136896802 GTGAGTGTACGTGCATGTTGTGG - Intergenic
1198531553 X:137553384-137553406 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
1199030865 X:142998176-142998198 GTGTGTGTGTGTGTGTGTTGAGG + Intergenic
1199574334 X:149298838-149298860 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1199726228 X:150585097-150585119 GTGTGTGTATGTGTGTGTGGGGG + Intronic
1199937375 X:152587978-152588000 GTACATGTATACACGTGTTGCGG + Intergenic
1199942448 X:152638817-152638839 GCGCGTGCATGCATGTGTTGAGG + Intronic
1200595033 Y:5129434-5129456 GTGTGTGTGTGTGTGTGTTGAGG - Intronic
1201531722 Y:14997207-14997229 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1201788275 Y:17808901-17808923 GTGCATGGATGAGCCTGTTGGGG + Intergenic
1201813278 Y:18097087-18097109 GTGCATGGATGAGCCTGTTGGGG - Intergenic