ID: 1186350243

View in Genome Browser
Species Human (GRCh38)
Location X:8732369-8732391
Sequence GAGGGGCCCAGCTCCCACGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 240}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186350234_1186350243 23 Left 1186350234 X:8732323-8732345 CCGGGGGAGGGCGACGCCGAGCG 0: 1
1: 0
2: 0
3: 11
4: 101
Right 1186350243 X:8732369-8732391 GAGGGGCCCAGCTCCCACGCAGG 0: 1
1: 0
2: 1
3: 17
4: 240
1186350242_1186350243 -10 Left 1186350242 X:8732356-8732378 CCGCGCAGGTCTCGAGGGGCCCA 0: 1
1: 0
2: 0
3: 10
4: 84
Right 1186350243 X:8732369-8732391 GAGGGGCCCAGCTCCCACGCAGG 0: 1
1: 0
2: 1
3: 17
4: 240
1186350239_1186350243 -5 Left 1186350239 X:8732351-8732373 CCACGCCGCGCAGGTCTCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1186350243 X:8732369-8732391 GAGGGGCCCAGCTCCCACGCAGG 0: 1
1: 0
2: 1
3: 17
4: 240
1186350236_1186350243 7 Left 1186350236 X:8732339-8732361 CCGAGCGGCTTTCCACGCCGCGC 0: 1
1: 0
2: 0
3: 4
4: 42
Right 1186350243 X:8732369-8732391 GAGGGGCCCAGCTCCCACGCAGG 0: 1
1: 0
2: 1
3: 17
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186350243 Original CRISPR GAGGGGCCCAGCTCCCACGC AGG Intergenic
900176868 1:1294924-1294946 GACAGGACCAGCTCCCACCCAGG + Intronic
900558028 1:3289817-3289839 CCGGGGCCCCGCTCCCACCCAGG + Intronic
900920112 1:5664633-5664655 GAGGGGCCTCGCTCCTAGGCAGG + Intergenic
900950889 1:5857859-5857881 GCAGGGCCCAGCTTCCACGTGGG + Intergenic
900953773 1:5874554-5874576 GGGGGGCCAGGCTGCCACGCAGG + Exonic
900962937 1:5937207-5937229 GTGGGGCCCAGCTCCTCCCCAGG - Intronic
901644162 1:10707651-10707673 CAGGGTCCCAGATCCCACCCAGG - Intronic
902374328 1:16023205-16023227 GTGAGGGCCAGCTCCCAGGCTGG + Intronic
902379285 1:16045082-16045104 GTGAGGGCCAGCTCCCAGGCTGG + Intronic
902512682 1:16974871-16974893 GAGGGCCCCAGATCCCAGGAGGG + Exonic
903186500 1:21632215-21632237 GAAGGGCCCAGCTCCTAAGTGGG + Intronic
903372780 1:22847592-22847614 GAGGGGCCCAGGGCCCAGGCAGG + Intronic
903595348 1:24489963-24489985 GAGGGAGCCAGCTCCCACCTCGG - Intergenic
904391834 1:30191079-30191101 GTGAGGCCCAGCTCTCACCCGGG - Intergenic
904426316 1:30425602-30425624 GAGGGGCCCTGCTCATACCCAGG - Intergenic
904433671 1:30480427-30480449 CAGGGTCCCAGCTGCCAGGCAGG + Intergenic
905263059 1:36732675-36732697 AAGGGGCTCAGCCCCCACTCAGG - Intergenic
905461182 1:38123958-38123980 GAGGGTCCCAGCCCGCACGCGGG + Intergenic
905651967 1:39662556-39662578 GAGGGGCCAGGCTTCCAGGCAGG + Intronic
906241213 1:44243272-44243294 GAGGGGACAAGCTCCTAGGCAGG + Intronic
914939893 1:152013526-152013548 GAGGGGCTGAGATCCCAGGCTGG + Intergenic
915956560 1:160225031-160225053 GCAGGGCCCAGCTCCTAGGCTGG - Intronic
916147128 1:161749985-161750007 GAGGAGCCCAGCTTCAAGGCGGG + Exonic
916496728 1:165354265-165354287 GACCGGCCCAGCTCCCGAGCCGG - Intronic
920509504 1:206540477-206540499 GGGCGGTTCAGCTCCCACGCGGG - Intronic
923686303 1:236155893-236155915 CAGGAGCTCAGCTCCCACCCAGG - Intronic
924744298 1:246818207-246818229 GAGGGCCCCAGATCCCAGGAGGG - Intergenic
1063958695 10:11288268-11288290 GGAGAGCCCAGCTCCCACCCAGG + Intronic
1065917345 10:30364872-30364894 GGGGTGCTCAGCTGCCACGCTGG + Intronic
1066563250 10:36692535-36692557 GAGTGGCCCAGCTCCGGCTCCGG + Intergenic
1067947073 10:50696397-50696419 GAGGGGCCCAGCAGCCATGTGGG - Intergenic
1070103784 10:73413693-73413715 GCGTGGCCCAGCTGCCTCGCGGG - Intronic
1070882386 10:79861387-79861409 GAGGGGCCCAGCAGCCATGTGGG - Intergenic
1070900300 10:80022641-80022663 GGGGCACCCAGCTCCCATGCTGG - Intergenic
1070902053 10:80038511-80038533 GGGGCACCCAGCTCCCATGCTGG - Intergenic
1071648956 10:87377698-87377720 GAGGGGCCCAGCAGCCATGTGGG - Intergenic
1072616238 10:97050413-97050435 CAGGGACCCAGCTCCCAACCGGG - Intronic
1074598335 10:114888107-114888129 TATGGCCCCAGCTCCCACGAGGG + Intronic
1075614820 10:123883279-123883301 CAGGGGCCCAGCACCTTCGCTGG + Intronic
1075626212 10:123966071-123966093 GAGGGTCCAAGCTCCCACCGTGG + Intergenic
1076479331 10:130774614-130774636 CAGGGGCCCGTCTCCCACGTGGG - Intergenic
1076603925 10:131677245-131677267 GAGGGGCCCAGGTTCCCAGCAGG + Intergenic
1076828819 10:132983892-132983914 CAGGGACCCAGAACCCACGCAGG - Intergenic
1076921713 10:133457716-133457738 AAGGGCCTCAGCTCTCACGCTGG + Intergenic
1077183910 11:1228167-1228189 GCGGGGCCCAGCTCACAGGGGGG - Intronic
1077444304 11:2583184-2583206 AAGGAGCCCAGCACCCACGAAGG - Intronic
1077636816 11:3847470-3847492 GAGGGTCCCTTCTCCCAGGCAGG + Intergenic
1079314844 11:19398789-19398811 GAGGGGCCCGGATCCCCAGCAGG - Intronic
1080434069 11:32223678-32223700 CAGGGTCCCAGCACCCACCCAGG + Intergenic
1082789202 11:57335675-57335697 CAGGGGCCCCGCTCCCCCACGGG - Intronic
1083195499 11:61083418-61083440 GAGGGTCCCTGCTCCCGGGCAGG - Intergenic
1083617399 11:64033176-64033198 TAGGTGCCCAGCCCCCATGCTGG + Intronic
1084219789 11:67670897-67670919 GAAGGGCCCAGGCCCCACCCAGG - Intronic
1084891265 11:72238194-72238216 GAGGGCCCCAGCTCCGCCCCCGG - Intronic
1086243262 11:84721035-84721057 GAGGTCCCGCGCTCCCACGCTGG - Intronic
1089314551 11:117582689-117582711 GAGGGGCCCGGCTTCCTGGCAGG - Intronic
1089325664 11:117655110-117655132 CATGGGGCCAGCTCACACGCAGG + Intronic
1089625789 11:119750027-119750049 GAAGGTCCCAGCTCCCCCTCAGG - Intergenic
1089667765 11:120031248-120031270 GTGGGGCCAAGCTCCCAGACAGG + Intergenic
1090188206 11:124751862-124751884 GAGAGGCCCAACTCGCTCGCCGG + Intronic
1091373908 12:14063-14085 GAGGTGACAAGCTCCCAGGCAGG - Intergenic
1091883411 12:3998332-3998354 GAAGGGCCCAGCTGCCACCGTGG + Intergenic
1092257968 12:6937336-6937358 CAGGGGCCCAGGTCCCACGGTGG - Exonic
1096100862 12:48969865-48969887 CAGGGACCCAGCTGCCTCGCTGG + Intronic
1098024745 12:66189551-66189573 GAGGGGGCCGGCTCCCTGGCGGG - Intronic
1098161311 12:67649546-67649568 GCGCGGCCCGGCTCCCCCGCCGG + Intronic
1103940805 12:124500264-124500286 GAGGGCTGCAGATCCCACGCAGG + Intronic
1104848756 12:131860924-131860946 CAGGGGCCCGGCTGCCACGGTGG - Intergenic
1104913842 12:132253875-132253897 GAGGGGAGCAGCTGCCACCCAGG - Intronic
1113435803 13:110290033-110290055 GGGGGGCACAGCACCCTCGCAGG + Intronic
1113842196 13:113366499-113366521 GGGGGACCCAGCTCCCTTGCAGG + Intergenic
1119804705 14:77475263-77475285 GAAGAGCCCAGCTCCCAAGGAGG + Exonic
1121436203 14:93921759-93921781 GAGGGCCCCATCTCCCTCCCAGG - Intronic
1122092047 14:99347252-99347274 AATGTGCCCAGCTCCCATGCTGG + Intergenic
1122278670 14:100608965-100608987 GAGGGGCCCAACGCCCAGGATGG + Intergenic
1122306447 14:100769618-100769640 GAGGGGCCCAGCACGGAAGCCGG - Intergenic
1122918397 14:104869281-104869303 CAGGGGCCCACGTGCCACGCTGG - Intronic
1123008552 14:105336072-105336094 CAGGCCCCCAGCTCCCACGCGGG + Intronic
1123039075 14:105483054-105483076 GTGGGGTCCAGCTGCCAGGCGGG + Intergenic
1124223042 15:27866152-27866174 GAAAGGACCAGCTCCCACCCAGG + Intronic
1127092134 15:55477975-55477997 GACTGCCCCAGCTCCCACGGAGG + Intronic
1127919018 15:63478566-63478588 GAGGTGCACAGAGCCCACGCTGG - Intergenic
1129038663 15:72665943-72665965 GGGGTGCTCAGCTCCCACCCTGG - Intronic
1129091148 15:73152320-73152342 GAGGGGCCCACCTCATATGCTGG + Intronic
1129211228 15:74071287-74071309 GGGGTGCTCAGCTCCCACCCTGG + Intronic
1129399175 15:75269800-75269822 GGGGTGCTCAGCTCCCACCCTGG - Intronic
1129402782 15:75294076-75294098 GGGGTGCTCAGCTCCCACCCTGG - Intronic
1131459869 15:92610451-92610473 GTGGGGCCCAGCGCCTAGGCGGG + Intergenic
1131514493 15:93067983-93068005 GAGGGGCCCACTTCACACCCAGG + Intronic
1132378652 15:101349733-101349755 GAGGAGCCTGGGTCCCACGCTGG - Intronic
1132466804 16:81360-81382 GGGGGGCCCAACTACCACTCTGG - Intronic
1132937369 16:2487993-2488015 GAAGGGGCCAGCTGCCCCGCTGG + Intronic
1134024646 16:10944644-10944666 GAGCGGCCCAGCGCCCGCGGCGG - Exonic
1136239026 16:28932979-28933001 GAGGGCCCCAGCTCCCCTTCCGG + Exonic
1136540204 16:30924314-30924336 GAGGGGCCGAGCGCCCTCGGGGG + Intronic
1138081253 16:54093428-54093450 GAGAAGCCCAGCTCCCTGGCAGG + Intronic
1138214183 16:55188827-55188849 GTGGGGCCCAGCTGCCTCCCTGG + Intergenic
1138478061 16:57283802-57283824 GAAGAGCCCGGCTCCCGCGCGGG + Intronic
1138577330 16:57916337-57916359 GAGAGGCCCAGCCCCCAGGGAGG + Intronic
1142149105 16:88504930-88504952 GTGGGGCCCAGCTCTCCTGCAGG - Intronic
1142159340 16:88548507-88548529 GCTGGGCCCAGCTCCCTCCCGGG + Intergenic
1142308551 16:89299296-89299318 GCAGGGCACAGATCCCACGCAGG - Intronic
1142381337 16:89733954-89733976 GAGCGGCCCTGCCCCCACCCTGG + Exonic
1142597497 17:1036631-1036653 GGGGTGCCCAGCGCCCACACAGG + Intronic
1142809335 17:2387834-2387856 GTGAGCCCCAGCCCCCACGCTGG - Intronic
1142995413 17:3757186-3757208 GAGGGGCTCAGCTCTCTCCCTGG - Intronic
1144846316 17:18221472-18221494 GAGGGCACCATCTCCCAGGCTGG - Intergenic
1147165040 17:38588613-38588635 GAGGGGCGCAGCACTCAGGCTGG - Intronic
1149446251 17:56715588-56715610 GAGGGGCCCACATCCCTCACAGG + Intergenic
1149611800 17:57962816-57962838 GAGGGGCACATCTCCCACTGAGG + Intergenic
1150135575 17:62693144-62693166 GCCCGGCCCAGCTCCCACCCTGG - Exonic
1150210320 17:63438087-63438109 GAGGGGCCCAGCCTCCCCACGGG + Intronic
1150764915 17:67994971-67994993 AAGGTGCCCAGCTCCCAAGCTGG - Intergenic
1151454487 17:74217902-74217924 CAGGCCCCCAGCTCCCACACTGG - Intronic
1151975317 17:77480912-77480934 GTGGCCCTCAGCTCCCACGCAGG - Intronic
1152249973 17:79207474-79207496 AAGGGGCCCTGGTGCCACGCTGG - Intronic
1152394497 17:80024043-80024065 GCGGGGCCCAAATCCCTCGCCGG + Intronic
1152630054 17:81406848-81406870 GAGGCGTCCAGCGCCCAAGCTGG + Intronic
1152740392 17:82016090-82016112 GAGGGGTGCAGCTGCCAGGCTGG - Intronic
1152816032 17:82408591-82408613 GAGGGGCCCTGCTCCCTCCCAGG + Intronic
1154139120 18:11807762-11807784 GGGGGGCCCAGCACCAACCCTGG + Intronic
1154388507 18:13916835-13916857 GAGTGGCCCAGGTCCCACCCAGG - Intergenic
1154502617 18:15004251-15004273 GAGGGGGACAGCTCCCATGAGGG - Intergenic
1160539623 18:79613490-79613512 GAGGGTCTCAGCTCCCGTGCTGG + Intergenic
1160820369 19:1054982-1055004 GAGGCTCCCAGCTCCCAGGTGGG - Intronic
1160851626 19:1195549-1195571 GAGAGGCCCAGGTCCCAGGTGGG - Intronic
1160851650 19:1195623-1195645 GAGAGGCCCAGGTCCCAGGTGGG - Intronic
1160852050 19:1197363-1197385 GAGAGGCCCAGGTCCCAGGTGGG - Intronic
1160852074 19:1197437-1197459 GAGAGGCCCAGGTCCCAGGTGGG - Intronic
1161153484 19:2721163-2721185 GAGGGGCCCCGGAGCCACGCGGG + Intronic
1161528207 19:4770498-4770520 CAAGGGCCCACCTCCCACCCAGG - Intergenic
1161605801 19:5214280-5214302 GAGGGCCCCAGCTTCTACCCAGG - Intronic
1162341916 19:10096410-10096432 GAGCGGCCCCGCATCCACGCGGG - Exonic
1162535871 19:11262529-11262551 GAAGGGCCCCGCCCCCGCGCCGG - Intergenic
1163283286 19:16330499-16330521 GGGGGCCCCAGCACCCAGGCAGG + Intergenic
1163666931 19:18607596-18607618 GCGGGACCCAGTTCCCGCGCAGG - Intronic
1163695695 19:18762212-18762234 GAGGTGCGCAGCTCCCGGGCGGG - Intronic
1164469802 19:28520444-28520466 GAGCGGCCCGGCTCCCTGGCCGG - Intergenic
1165327787 19:35124408-35124430 GAGCGGCCCAGGTCCCAGGGAGG - Intergenic
1166717841 19:44980119-44980141 GAGGGTCCCAGCTCCAAGGCTGG - Intronic
1166983960 19:46648976-46648998 CCGCGGCCCAGCGCCCACGCTGG - Exonic
1167152221 19:47716856-47716878 GAGGTGCCCGGCTCCCGCGTGGG + Exonic
1168329804 19:55561087-55561109 GATGGGGCCAGCTGCCATGCTGG - Intergenic
1168354224 19:55691915-55691937 GGGAGGTCCAGCCCCCACGCCGG + Exonic
1168687449 19:58357406-58357428 GCGGGGCCCAGCTCCCTGCCGGG + Exonic
926226696 2:10971901-10971923 GCAGGGCCCAGCTCACACACAGG - Intergenic
926246317 2:11124249-11124271 GAGCCTCCCAGCTCCCACTCTGG - Intergenic
927645505 2:24874542-24874564 GAGGTGGCCAGCTCCCAGGTTGG - Intronic
929584041 2:43102216-43102238 GAGAGGCCCAGGTCCCAGGTCGG + Intergenic
931711630 2:64992835-64992857 GAGGAGCTCAGCCTCCACGCTGG - Intronic
932409230 2:71535349-71535371 GAGGGACCCAGCGCCCCCTCAGG - Intronic
934573502 2:95385924-95385946 GAGGGGTCTGCCTCCCACGCTGG + Exonic
935134521 2:100288218-100288240 AGGGAGCCCAGCTCCCAGGCTGG - Intronic
935904943 2:107829588-107829610 GACGGGCGCTGCTCCCAGGCGGG + Intronic
936381983 2:111994348-111994370 GAAGGGCCCAACTCCCCCTCTGG - Exonic
936463350 2:112727017-112727039 TAAGGGCCCAGCTAGCACGCAGG - Intronic
938501787 2:131834421-131834443 GAGGGGGACAGCTCCCATGACGG - Intergenic
944563321 2:200963385-200963407 TAGGGGCCAAGCTCCGACGCGGG + Intronic
944656401 2:201880582-201880604 GAAAGGCCCAGCTCCCTCTCAGG - Intronic
945225713 2:207529845-207529867 GAGCGGCCCCGCCCCCGCGCTGG - Intronic
946056744 2:216909620-216909642 GGGAGGCCCAGCTCCGAGGCCGG - Intergenic
946405716 2:219490959-219490981 GAGGGGACCAGCTGCCAGCCAGG + Intronic
947007453 2:225528646-225528668 TAGGGGACCAGTTCCCATGCTGG - Intronic
947743602 2:232496548-232496570 TAGGGGCCCAGCCCCCATGGAGG - Intergenic
948149813 2:235736223-235736245 GAAGGGACCAGCGCCCACCCTGG - Intronic
948164749 2:235852347-235852369 GGAGGGCCCTGCTCCCTCGCTGG - Intronic
948274044 2:236694790-236694812 GAGGGGCCCAGCCCCCACCCAGG - Intergenic
948790514 2:240374292-240374314 GAGGGCTGCAGCTCCCACACAGG - Intergenic
948913555 2:241018674-241018696 GAGACGCCCTGCTCCCAGGCTGG + Intronic
948942864 2:241204740-241204762 TAGGGCCCCAGCCCCCAAGCTGG + Intronic
949021408 2:241743149-241743171 GAGAGGCCCAGCTCCAGAGCAGG - Intronic
1168814738 20:728698-728720 GAGGGGCCCAGCTCCCGACAGGG - Intergenic
1174049371 20:47757151-47757173 GAGGGGCCGAGGTGCCACCCTGG + Intronic
1175503018 20:59463685-59463707 GAGTGGCCAAGCTCCCAAGGTGG - Intergenic
1175802453 20:61808696-61808718 GACGGGAGCAGCTCCCACACTGG - Intronic
1175891327 20:62317305-62317327 GAGGGGCCCTGGGCCCACCCTGG - Intronic
1175989511 20:62780900-62780922 GTGTGGCCCAGCCCCCACTCCGG + Intergenic
1176264986 20:64204452-64204474 GTGGGTCCCAGCTTCCACGCAGG - Intronic
1179133551 21:38660479-38660501 GACCTGCCCGGCTCCCACGCTGG - Intronic
1179800253 21:43808408-43808430 AAGGGGCGCAGCACCCACTCCGG - Intergenic
1180998856 22:19978603-19978625 GAAGGTCCCAGCTCCCCCTCTGG + Intronic
1181475534 22:23165695-23165717 TAGTGGCCCAGCTACCAAGCAGG - Intergenic
1182605173 22:31497106-31497128 CAGGTACCCACCTCCCACGCGGG - Intronic
1184821901 22:46915707-46915729 AAAGAGCCCAGCTCCCACTCAGG - Intronic
1185343656 22:50302237-50302259 GTGGGGCCCAGCCCACACCCTGG - Intronic
953419924 3:42746581-42746603 GAGGGGCCCAGGTCACAAGCTGG - Intronic
955358526 3:58252078-58252100 GAGAGGGCCAGCTGCCACACTGG + Intronic
956765793 3:72483131-72483153 GAGGGGCGCTGAACCCACGCTGG - Intergenic
957788078 3:84906140-84906162 CAGGGAGCCAGCCCCCACGCTGG + Intergenic
966390811 3:179451132-179451154 GTCGCGCCCAGCTGCCACGCGGG - Intronic
968619181 4:1596064-1596086 GAGGGTCCCTGCTCCTGCGCTGG + Intergenic
968911943 4:3480899-3480921 GAGGGGCACAGACCCCAGGCTGG + Intronic
969414541 4:7050046-7050068 GAGGGCCCCACCTGCCACCCAGG - Intronic
981349207 4:143709405-143709427 GAGGGGCAGAGCTGCCACTCAGG - Intergenic
982347251 4:154373690-154373712 GAGGGGCCCTGCTTCCAAGAGGG + Intronic
985784571 5:1887061-1887083 GAGCGGCCCAGCGCCACCGCAGG - Exonic
985885708 5:2676141-2676163 GAGGGTCCCAGAGCCCACCCTGG + Intergenic
986050242 5:4083626-4083648 AAGGGTCCCAGCTCCCAGGAGGG + Intergenic
986311518 5:6554302-6554324 GAGGGGCCCTGGTCCCACCCTGG - Intergenic
988164697 5:27571589-27571611 GAGGCGCCAAACTCCCACACAGG + Intergenic
990161374 5:52943935-52943957 GTGGGGCGCAGCACCCAGGCTGG + Intronic
992069620 5:73136779-73136801 TAGGGGACCAGATCCCACCCAGG + Intergenic
993899033 5:93572065-93572087 GCGGGACCCAGCTGCCGCGCAGG + Intergenic
997463970 5:134074453-134074475 CTGGGGCCCAACTCCCACCCAGG - Intergenic
997692158 5:135834230-135834252 TAGGGGCCCAGCTCCCTGCCTGG - Intergenic
999341572 5:150778134-150778156 GGGTGGCCCAGCTTCCACGCAGG - Exonic
999696249 5:154190690-154190712 GCGGCGCCCAGCTCCCCGGCCGG + Intronic
1000210187 5:159100915-159100937 GAGGGGCACGGCCTCCACGCTGG + Intergenic
1001133250 5:169081323-169081345 CAGAGGCCCAGCTGCCCCGCTGG - Intronic
1001403300 5:171459167-171459189 GGGGTGCCCACCTCCCACGCAGG - Intergenic
1006337470 6:33428065-33428087 GAGGGGCCCCGCCCCTGCGCGGG - Intronic
1006394445 6:33777949-33777971 GTGGGGCCCAGCTCCTGCTCAGG + Intronic
1006475073 6:34248108-34248130 GTGGGGCCCAGCTCAGATGCTGG + Intronic
1007455692 6:41975436-41975458 GAGTGGCCCTACTCCCAGGCTGG + Intronic
1007702105 6:43771505-43771527 GAGAGGCTCACCGCCCACGCGGG + Intronic
1011754273 6:90483151-90483173 GTGGAGCCCAGCTCACACCCAGG - Intergenic
1011931758 6:92723455-92723477 GAGGGGGCCAGCTCCAACCTTGG - Intergenic
1013613478 6:111818582-111818604 CAGGGGCCCAGCTCCCTCCATGG + Intronic
1014105694 6:117558269-117558291 GAGGGGGGCAGCTCCCAAGGAGG - Intronic
1017139596 6:151178664-151178686 GAGGGGTGCAGCTCCTACCCTGG + Intergenic
1017757781 6:157544234-157544256 CAAGGGCCCAGCTCCCATACTGG + Intronic
1019305586 7:332918-332940 GGGGGGCCCCGCTCCCAAGCTGG - Intergenic
1019446080 7:1072038-1072060 GAGGGGCCCAGCGCTCAGGATGG + Intronic
1019524337 7:1474017-1474039 CTGGGGACCAGCTCCCACCCTGG - Intronic
1020094613 7:5361523-5361545 GAGGAGCCCGGGCCCCACGCAGG - Intronic
1024611466 7:51068031-51068053 CAGGAGCCCAGCTGCCAGGCTGG - Intronic
1026474810 7:70725877-70725899 CAGGCGCCCACCACCCACGCTGG - Intronic
1035292612 7:157849306-157849328 GATGGCCCCAGCTCACACACTGG - Intronic
1035459947 7:159032398-159032420 GATGGGCCGGGCTCCCAGGCGGG - Intronic
1035609235 8:949040-949062 CACGGGCCCTGCTCCCACCCTGG - Intergenic
1036508958 8:9382905-9382927 CCCGGGCCCAGGTCCCACGCAGG - Intergenic
1039064905 8:33599487-33599509 GCGGGGCCCGGCTGCCAGGCTGG - Intronic
1044582184 8:93834337-93834359 GAGGCGCCCACTTCCCAGGCGGG + Intergenic
1048345225 8:133570827-133570849 GGGTGGCCCTGCCCCCACGCAGG + Intronic
1049436513 8:142588575-142588597 GAAGGCCCCAGCTCCAACCCTGG - Intergenic
1049967910 9:796015-796037 GAGGGGCCCACCCTCCACCCAGG - Intergenic
1051506275 9:17831000-17831022 GAGGGGCCCACTTCACTCGCGGG + Intergenic
1056575945 9:87856292-87856314 GAGGGGCCCAGCAGCCACATGGG + Intergenic
1057141659 9:92730048-92730070 GAGTGGCCCAGCCTCCAAGCAGG + Intronic
1057304325 9:93903564-93903586 GAGGGGCCCAGCTCCTGCTGTGG - Intergenic
1057572917 9:96218026-96218048 GAGGGGCCCACCTCCAGCCCTGG - Intergenic
1059335307 9:113565178-113565200 GAGGGGCCCAGCTGGCTCCCGGG - Intronic
1059401961 9:114076300-114076322 GAGGAGCCCAGTTCCCAGGTTGG + Intronic
1060302646 9:122384295-122384317 CAGGGGCCAAGCTCCCAGGCAGG - Intronic
1060549751 9:124479338-124479360 GAGGCCTCCAGCTTCCACGCTGG + Intergenic
1060736623 9:126070298-126070320 GAGCGGCCCATATCTCACGCTGG + Intergenic
1061024735 9:128041164-128041186 GAGGGTCCCACCTCACACCCTGG + Intergenic
1061108863 9:128552752-128552774 GAGCTGCCCAGCTCCCACCCGGG - Intronic
1062105223 9:134751458-134751480 GAGGAGCCCAGCTCCAGCCCAGG - Intronic
1062189280 9:135239446-135239468 GGGGGGCTCAGCTCCCAGGGTGG - Intergenic
1062494789 9:136826600-136826622 CAGGGGCCCAGCACCCCTGCGGG - Intronic
1186350243 X:8732369-8732391 GAGGGGCCCAGCTCCCACGCAGG + Intergenic
1187803767 X:23095755-23095777 GGGATGCCCAGCTCCCATGCTGG - Intergenic
1190743393 X:53305790-53305812 GAGGGGCCAAGCTTGCAGGCTGG - Intronic
1195365179 X:104117590-104117612 GAGGACCCCACCACCCACGCAGG + Intronic
1200076572 X:153554235-153554257 GCGGGGCCCATTTCCCTCGCTGG - Intronic
1200252735 X:154562370-154562392 GAGGTGCACTCCTCCCACGCAGG - Intronic
1200265032 X:154642046-154642068 GAGGTGCACTCCTCCCACGCAGG + Intergenic
1201634877 Y:16111833-16111855 GAGAGGCCCCGCTCCCCTGCTGG + Intergenic