ID: 1186350361

View in Genome Browser
Species Human (GRCh38)
Location X:8732852-8732874
Sequence TCCACACGCCTTGTTTCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186350355_1186350361 29 Left 1186350355 X:8732800-8732822 CCGCACTGTTTTCCCTGGAGACA No data
Right 1186350361 X:8732852-8732874 TCCACACGCCTTGTTTCCTCAGG No data
1186350354_1186350361 30 Left 1186350354 X:8732799-8732821 CCCGCACTGTTTTCCCTGGAGAC No data
Right 1186350361 X:8732852-8732874 TCCACACGCCTTGTTTCCTCAGG No data
1186350357_1186350361 16 Left 1186350357 X:8732813-8732835 CCTGGAGACAGTCTCAGTGCATA No data
Right 1186350361 X:8732852-8732874 TCCACACGCCTTGTTTCCTCAGG No data
1186350356_1186350361 17 Left 1186350356 X:8732812-8732834 CCCTGGAGACAGTCTCAGTGCAT No data
Right 1186350361 X:8732852-8732874 TCCACACGCCTTGTTTCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186350361 Original CRISPR TCCACACGCCTTGTTTCCTC AGG Intergenic
No off target data available for this crispr