ID: 1186360707

View in Genome Browser
Species Human (GRCh38)
Location X:8837919-8837941
Sequence ATCACAAAGAGAAAGCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186360707_1186360713 30 Left 1186360707 X:8837919-8837941 CCCTCCAGCTTTCTCTTTGTGAT No data
Right 1186360713 X:8837972-8837994 AAGCCCCAGAATTAAAAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186360707 Original CRISPR ATCACAAAGAGAAAGCTGGA GGG (reversed) Intergenic
No off target data available for this crispr