ID: 1186363973

View in Genome Browser
Species Human (GRCh38)
Location X:8872588-8872610
Sequence CATGCTACTGGCCTTGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186363969_1186363973 7 Left 1186363969 X:8872558-8872580 CCAGAGAGAGACAGAGAAATGGG No data
Right 1186363973 X:8872588-8872610 CATGCTACTGGCCTTGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186363973 Original CRISPR CATGCTACTGGCCTTGAAAA TGG Intergenic
No off target data available for this crispr