ID: 1186370227

View in Genome Browser
Species Human (GRCh38)
Location X:8938882-8938904
Sequence ATCATGTGGAGAATTAGTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186370227_1186370231 24 Left 1186370227 X:8938882-8938904 CCATTACTAATTCTCCACATGAT No data
Right 1186370231 X:8938929-8938951 TAACTGCATGTTTTAGGTATGGG No data
1186370227_1186370229 18 Left 1186370227 X:8938882-8938904 CCATTACTAATTCTCCACATGAT No data
Right 1186370229 X:8938923-8938945 ATGATGTAACTGCATGTTTTAGG No data
1186370227_1186370230 23 Left 1186370227 X:8938882-8938904 CCATTACTAATTCTCCACATGAT No data
Right 1186370230 X:8938928-8938950 GTAACTGCATGTTTTAGGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186370227 Original CRISPR ATCATGTGGAGAATTAGTAA TGG (reversed) Intergenic
No off target data available for this crispr