ID: 1186370230

View in Genome Browser
Species Human (GRCh38)
Location X:8938928-8938950
Sequence GTAACTGCATGTTTTAGGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186370228_1186370230 9 Left 1186370228 X:8938896-8938918 CCACATGATCATAATAATAATTA No data
Right 1186370230 X:8938928-8938950 GTAACTGCATGTTTTAGGTATGG No data
1186370227_1186370230 23 Left 1186370227 X:8938882-8938904 CCATTACTAATTCTCCACATGAT No data
Right 1186370230 X:8938928-8938950 GTAACTGCATGTTTTAGGTATGG No data
1186370226_1186370230 27 Left 1186370226 X:8938878-8938900 CCATCCATTACTAATTCTCCACA No data
Right 1186370230 X:8938928-8938950 GTAACTGCATGTTTTAGGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186370230 Original CRISPR GTAACTGCATGTTTTAGGTA TGG Intergenic
No off target data available for this crispr